About   Help   FAQ
D18Mit19 Primer Detail
Primers
  • Name
    D18Mit19
  • Primer 1 Sequence
    ATTGGGTGTTCAGGTGCAG
  • Primer 2 Sequence
    ATGCACAATAGCTCATAGCTTCT
  • ID
    MGI:700455
  • Product Size
    150
  • Other IDs
    D18Mit19 (BROAD)
  • Note
    MIT assay: A685
    Additional information: MIT STS Marker Data Files
Genes
D18Mit19 DNA segment, Chr 18, Massachusetts Institute of Technology 19
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D18Mit19 a 156bp 129X1/Sv
f 154, 156bp CD-1
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D18Mit19 c 160bp C3HeB/FeJLe
f smaller FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D18Mit19 a 138bp AKR/J, LP/J
b 140bp CAST/EiJ
c 152bp SPRET/EiJ
d 154bp B6.Cg-Lepob/+, C57BL/6J, NOD/MrkTac
e 156bp BALB/cJ
f 158bp A/J
g 160bp C3H/HeJ, DBA/2J, NON/ShiLt
J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3
Endonuclease Gene Allele Fragments Strains
D18Mit19 c larger C58/J
f not given FVB/NJ
i not given I/LnJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D18Mit19 c 158bp CBA/CaOlaHsd
s 156bp SWR/OlaHsd
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory