D1Mit150 Primer Detail MGI Mouse MGI:700445

D1Mit150 Primer Detail

Name

D1Mit150
Primer 1 Sequence

CTGGTGTCCACACACAGGTC
Primer 2 Sequence

TGATTGCAATATACCAGGTTTCC
ID

MGI:700445
Product Size

138
Other IDs

D1Mit150 (BROAD)
Note

MIT assay: MPC1817
Additional information: MIT STS Marker Data Files

D1Mit150

DNA segment, Chr 1, Massachusetts Institute of Technology 150

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D1Mit150	c	126bp	C3HeB/FeJLe
	D1Mit150	f	larger	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D1Mit150	a	118bp	SPRET/EiJ
	b	126bp	AKR/J, BALB/cJ, C3H/HeJ, DBA/2J, LP/J, NOD/MrkTac
	c	134bp	A/J, NON/ShiLt
	d	138bp	B6.Cg-Lep^ob/+, C57BL/6J
	e	154bp	CAST/EiJ

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 09/30/2025 MGI 6.24