About   Help   FAQ
D18Mit75 Primer Detail
Primers
  • Name
    D18Mit75
  • Primer 1 Sequence
    TGAAACTCATTTAGATACATACACACA
  • Primer 2 Sequence
    TTCAGCAGTTGGATGCAGAC
  • ID
    MGI:700421
  • Product Size
    218
  • Other IDs
    D18Mit75 (BROAD)
  • Note
    MIT assay: MPC1192
    Additional information: MIT STS Marker Data Files
Genes
D8Mit1004 DNA segment, Chr 8, Massachusetts Institute of Technology 1004
Polymorphisms
J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70
Endonuclease Gene Allele Fragments Strains
Not Specified D8Mit1004 m 258bp MOLF/EiJ
s 238bp 129/Sv
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D8Mit1004 a 114bp CAST/EiJ
b 118bp A/J, AKR/J, B6.Cg-Lepob/+, BALB/cJ, C3H/HeJ, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
c 128bp SPRET/EiJ
References
J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory