D10Mit248 Primer Detail MGI Mouse MGI:700390

D10Mit248 Primer Detail

Name

D10Mit248
Primer 1 Sequence

GAATGTACATTTTTTCCTTTTCTCTT
Primer 2 Sequence

ACTATAACTCAACCAATATTGTGTGTG
ID

MGI:700390
Product Size

143
Other IDs

D10Mit248 (BROAD)
Note

MIT assay: MTH1842
Additional information: MIT STS Marker Data Files

DNA Segment, Chr 10, Massachusetts Institute of Technology 248

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D10Mit248	a	155bp	129X1/Sv
Not Specified	D10Mit248	f	140, 144, 151bp	CD-1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D10Mit248	a	143bp	AKR/J, B6.Cg-Lep^ob/+, C57BL/6J, NOD/MrkTac
	b	155bp	A/J, BALB/cJ, C3H/HeJ, CAST/EiJ, LP/J
	c	173bp	NON/ShiLt
	d	181bp	DBA/2J
	e	199bp	SPRET/EiJ

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 06/12/2024 MGI 6.13