About   Help   FAQ
D11Mit50 Primer Detail
Primers
  • Name
    D11Mit50
  • Primer 1 Sequence
    GAAAGGGGGCAGAGAGTCTT
  • Primer 2 Sequence
    TGTACAACTTGACTGTTGATCACA
  • ID
    MGI:700386
  • Product Size
    174
  • Note
    MIT assay: B361
Genes
D11Mit50 DNA segment, Chr 11, Massachusetts Institute of Technology 50
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D11Mit50 a 144bp AKR/J
b 148bp BALB/cJ, NOD/MrkTac
c 172bp A/J, C3H/HeJ, DBA/2J, NON/ShiLt
d 174bp B6.Cg-Lepob/+
e 176bp C57BL/6J
f 178bp SPRET/EiJ
g 220bp CAST/EiJ
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D11Mit50 l smaller LG/J
s larger SM/J
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory