About   Help   FAQ
D7Mit62 Primer Detail
Primers
  • Name
    D7Mit62
  • Primer 1 Sequence
    CACTGTATGCAAAATTCTCAAAGA
  • Primer 2 Sequence
    TAGGATGACCTCTATATGTCTGCC
  • ID
    MGI:700352
  • Product Size
    147
  • Other IDs
    D7Mit62 (BROAD)
  • Note
    MIT assay: B671
    Additional information: MIT STS Marker Data Files
Genes
D7Mit62 DNA segment, Chr 7, Massachusetts Institute of Technology 62
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D7Mit62 a 134bp AKR/J, BALB/cJ, NOD/MrkTac, NON/ShiLt
b 136bp A/J
c 148bp B6.Cg-Lepob/+, C57BL/6J
d 158bp C3H/HeJ, DBA/2J, LP/J, SPRET/EiJ
e 164bp CAST/EiJ
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D7Mit62 l larger LG/J
s smaller SM/J
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D7Mit62 a 158bp C3H/W, DBA/2W
b 148bp 129/SvW, C57BL/6W, C57BL/10W, CBA/W
c 134bp A.CA/W, AKR/W, BALB/cW, BN/aW
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/31/2026
MGI 6.24
The Jackson Laboratory