About   Help   FAQ
D7Mit69 Primer Detail
Primers
  • Name
    D7Mit69
  • Primer 1 Sequence
    CCCACCAGAGATCACCAAGT
  • Primer 2 Sequence
    CACAATGAAGGCTGAAAGCA
  • ID
    MGI:700349
  • Product Size
    233
  • Other IDs
    D7Mit69 (BROAD)
  • Note
    MIT assay: B502
    Additional information: MIT STS Marker Data Files
Genes
D7Mit69 DNA segment, Chr 7, Massachusetts Institute of Technology 69
Polymorphisms
J:40661 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):390-3
Endonuclease Gene Allele Fragments Strains
Not Specified D7Mit69 a 236bp 129S/SvEv, 129T1/Sv-Dnd1Ter, 129X1/Sv, C3HeB/FeJ
b 230bp 129P1/ReJ, 129P2/Ola, 129P3/J, 129P4/RrRkJ, 129X1/SvJ, C3HeB/FeJ
c 232bp C57BL/6J
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D7Mit69 a 236bp 129X1/Sv, CD-1
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D7Mit69 a 220bp SPRET/EiJ
b 234bp NOD/MrkTac
c 236bp A/J, AKR/J, B6.Cg-Lepob/+, C57BL/6J, LP/J
d 238bp BALB/cJ, C3H/HeJ, DBA/2J
e 240bp NON/ShiLt
f 274bp CAST/EiJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D7Mit69 c 237bp CBA/CaOlaHsd
s 230bp SWR/OlaHsd
References
J:40661 Threadgill DW, et al., Genealogy of the 129 inbred strains: 129/SvJ is a contaminated inbred strain. Mamm Genome. 1997 Jun;8(6):390-3
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/29/2025
MGI 6.24
The Jackson Laboratory