About   Help   FAQ
D5Mit31 Primer Detail
Primers
  • Name
    D5Mit31
  • Primer 1 Sequence
    TCAGGGCTCTCTAAGGGACA
  • Primer 2 Sequence
    ACTATGCAGCCACCAAATCC
  • ID
    MGI:700346
  • Product Size
    220
  • Other IDs
    D5Mit31 (BROAD)
  • Note
    MIT assay: A66
    Additional information: MIT STS Marker Data Files
Genes
D5Mit31 DNA segment, Chr 5, Massachusetts Institute of Technology 31
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D5Mit31 a 208bp C3H/HeJ, DBA/2J
b 210bp AKR/J, B6.Cg-Lepob/+, C57BL/6J, NON/ShiLt
c 212bp SPRET/EiJ
d 238bp A/J, BALB/cJ, NOD/MrkTac
e 240bp CAST/EiJ
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D5Mit31 a 222bp 129P3/J, AKR/OlaHsd, C57BL/6JOlaHsd, C57BL/10
c 238bp BALB/cJ
d 218bp C3H/HeJ, DBA/2J
j 234bp JF1
l 246bp SJL/J
p 220bp PWB
w 242bp A/JOlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/13/2026
MGI 6.24
The Jackson Laboratory