D5Mit31 Primer Detail MGI Mouse MGI:700346

D5Mit31 Primer Detail

Name

D5Mit31
Primer 1 Sequence

TCAGGGCTCTCTAAGGGACA
Primer 2 Sequence

ACTATGCAGCCACCAAATCC
ID

MGI:700346
Product Size

220
Other IDs

D5Mit31 (BROAD)
Note

MIT assay: A66
Additional information: MIT STS Marker Data Files

D5Mit31

DNA segment, Chr 5, Massachusetts Institute of Technology 31

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D5Mit31	a	208bp	C3H/HeJ, DBA/2J
	b	210bp	AKR/J, B6.Cg-Lep^ob/+, C57BL/6J, NON/ShiLt
	c	212bp	SPRET/EiJ
	d	238bp	A/J, BALB/cJ, NOD/MrkTac
	e	240bp	CAST/EiJ

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
D5Mit31	a	222bp	129P3/J, AKR/OlaHsd, C57BL/6JOlaHsd, C57BL/10
	c	238bp	BALB/cJ
	d	218bp	C3H/HeJ, DBA/2J
	j	234bp	JF1
	l	246bp	SJL/J
	p	220bp	PWB
	w	242bp	A/JOlaHsd

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/07/2024 MGI 6.23