About   Help   FAQ
D4Mit9 Primer Detail
Primers
  • Name
    D4Mit9
  • Primer 1 Sequence
    GGCTTTGGAATGCTATGCAT
  • Primer 2 Sequence
    TGGCAGGAGGTATGACAGAA
  • ID
    MGI:700343
  • Product Size
    197
  • Other IDs
    D4Mit9 (BROAD)
  • Note
    MIT assay: M241
    Additional information: MIT STS Marker Data Files
Genes
D4Mit9 DNA segment, Chr 4, Massachusetts Institute of Technology 9
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D4Mit9 c 210bp C3HeB/FeJLe
f smaller FVB/N
J:42684 Koide T, et al., Mamm Genome. 1998 Jan;9(1):15-9
Endonuclease Gene Allele Fragments Strains
Not Specified D4Mit9 a largest MSM/Ms
b smaller C57BL/6, DBA/2, JF1
J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70
Endonuclease Gene Allele Fragments Strains
Not Specified D4Mit9 m 195bp MOLF/EiJ
s 236bp 129/Sv
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D4Mit9 a 195bp AKR/J
b 200bp LP/J, NON/ShiLt
c 206bp B6.Cg-Lepob/+, C57BL/6J
d 208bp DBA/2J
e 210bp A/J, BALB/cJ, C3H/HeJ, NOD/MrkTac
f 212bp CAST/EiJ
g 238bp SPRET/EiJ
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D4Mit9 l smaller LG/J
s larger SM/J
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:42684 Koide T, et al., A new inbred strain JF1 established from Japanese fancy mouse carrying the classic piebald allele [published erratum appears in Mamm Genome 1998 Apr;9(4):344]. Mamm Genome. 1998 Jan;9(1):15-9
J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support. 		last database update
09/30/2025
MGI 6.24 		The Jackson Laboratory