About   Help   FAQ
D7Mit118 Primer Detail
Primers
  • Name
    D7Mit118
  • Primer 1 Sequence
    ATATCCTAAAGAACATTAATGTCCAGA
  • Primer 2 Sequence
    TGAGCATTCTCTGTTTAGATCTGC
  • ID
    MGI:700301
  • Product Size
    143
  • Other IDs
    D7Mit118 (BROAD)
  • Note
    MIT assay: MPC2467
    Additional information: MIT STS Marker Data Files
Genes
D7Mit118a DNA segment, Chr 7, Massachusetts Institute of Technology 118a
D7Mit118b DNA segment, Chr 7, Massachusetts Institute of Technology 118b
Polymorphisms
J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70
Endonuclease Gene Allele Fragments Strains
Not Specified D7Mit118a m 187bp MOLF/EiJ
s 162bp 129/Sv
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D7Mit118a a 126bp B6.Cg-Lepob/+
b 146bp AKR/J, C3H/HeJ, C57BL/6J, DBA/2J
c 154bp SPRET/EiJ
d 158bp CAST/EiJ
References
J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/08/2026
MGI 6.24
The Jackson Laboratory