About   Help   FAQ
D4Mit174 Primer Detail
Primers
  • Name
    D4Mit174
  • Primer 1 Sequence
    GAACCACATGGTTGTCTTTTCA
  • Primer 2 Sequence
    GTGATTGATACAGGCTGTTTTCC
  • ID
    MGI:700251
  • Product Size
    132
  • Other IDs
    D4Mit174 (BROAD)
  • Note
    MIT assay: D1128
    Additional information: MIT STS Marker Data Files
Genes
D4Mit174 DNA segment, Chr 4, Massachusetts Institute of Technology 174
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D4Mit174 a 113bp CAST/EiJ
b 131bp BALB/cJ, DBA/2J
c 133bp AKR/J, B6.Cg-Lepob/+, C3H/HeJ, C57BL/6J, LP/J, NOD/MrkTac, NON/ShiLt
d 135bp A/J
e 173bp SPRET/EiJ
J:54496 Rogers MJ, et al., Mamm Genome. 1999 May;10(5):513-9
Endonuclease Gene Allele Fragments Strains
D4Mit174 c 0.11kb CAST/EiJ
p 0.13kb STOCK Whrnwi
w 0.13kb STOCK Whrnwi
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:54496 Rogers MJ, et al., Genetic mapping of the whirler mutation. Mamm Genome. 1999 May;10(5):513-9
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support. 		last database update
04/23/2024
MGI 6.23 		The Jackson Laboratory