About   Help   FAQ
D4Mit171 Primer Detail
Primers
  • Name
    D4Mit171
  • Primer 1 Sequence
    CAGGTGTAATAATGGTTTTTTGACC
  • Primer 2 Sequence
    CATATTAAATAAACACAGCAGCACG
  • ID
    MGI:700248
  • Product Size
    318
  • Other IDs
    D4Mit171 (BROAD)
  • Note
    MIT assay: D1104
    Additional information: MIT STS Marker Data Files
Genes
D4Mit171 DNA segment, Chr 4, Massachusetts Institute of Technology 171
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D4Mit171 a 299bp LP/J
b 313bp B6.Cg-Lepob/+, C57BL/6J
c 329bp A/J, BALB/cJ, DBA/2J, NOD/MrkTac, SPRET/EiJ
d 333bp AKR/J, C3H/HeJ, NON/ShiLt
e 345bp CAST/EiJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D4Mit171 c 160bp CBA/CaOlaHsd
s 169bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/31/2026
MGI 6.24
The Jackson Laboratory