D4Mit170 Primer Detail MGI Mouse MGI:700247

D4Mit170 Primer Detail

Name

D4Mit170
Primer 1 Sequence

TTCCATCGAGTGACTTGATCC
Primer 2 Sequence

CAGAGTGGCTGTCATCTGGA
ID

MGI:700247
Product Size

105
Other IDs

D4Mit170 (BROAD)
Note

MIT assay: MTH204
Additional information: MIT STS Marker Data Files

D4Mit170

DNA segment, Chr 4, Massachusetts Institute of Technology 170

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D4Mit170	b	smaller	C57BL/6J
	D4Mit170	f	117bp	FVB/N

J:41730 Natochin M, et al., J Biol Chem. 1997 Jul 11;272(28):17444-9

Endonuclease	Gene	Allele	Fragments	Strains
	D4Mit170	b	smaller	C57BL/6J
	D4Mit170	f	larger	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D4Mit170	a	105bp	A/J, B6.Cg-Lep^ob/+, C57BL/6J, LP/J, NOD/MrkTac, NON/ShiLt
	b	117bp	AKR/J, C3H/HeJ
	c	121bp	BALB/cJ, DBA/2J
	d	125bp	CAST/EiJ
	e	145bp	SPRET/EiJ

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:41730 Natochin M, et al., Regulation of transducin GTPase activity by human retinal RGS. J Biol Chem. 1997 Jul 11;272(28):17444-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/07/2024 MGI 6.23