D4Mit12 Primer Detail MGI Mouse MGI:700237

D4Mit12 Primer Detail

Name

D4Mit12
Primer 1 Sequence

GCTTGCTTTAGGAGTGTGCC
Primer 2 Sequence

TATTTGCTCTCCATTTCCCC
ID

MGI:700237
Product Size

197
Other IDs

D4Mit12 (BROAD)
Note

MIT assay: M15
Additional information: MIT STS Marker Data Files

D4Mit12

DNA segment, Chr 4, Massachusetts Institute of Technology 12

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D4Mit12	b	larger	C57BL/6J
	D4Mit12	F	smaller	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D4Mit12	a	167bp	NOD/MrkTac
	b	168bp	A/J, BALB/cJ, C3H/HeJ, DBA/2J
	c	169bp	NON/ShiLt
	d	170bp	AKR/J, LP/J
	e	185bp	SPRET/EiJ
	f	190bp	CAST/EiJ
	g	198bp	B6.Cg-Lep^ob/+, C57BL/6J

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D4Mit12	c	129bp	CBA/CaOlaHsd
	D4Mit12	s	123bp	SWR/OlaHsd

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/21/2024 MGI 6.23