About   Help   FAQ
D4Mit15 Primer Detail
Primers
  • Name
    D4Mit15
  • Primer 1 Sequence
    AGGAATACTGAATGTGGACTTTCC
  • Primer 2 Sequence
    TCCCTTGATTAACAGAAGACCTG
  • ID
    MGI:700236
  • Product Size
    284
  • Other IDs
    D4Mit15 (BROAD)
  • Note
    MIT assay: A122
    Additional information: MIT STS Marker Data Files
Genes
D4Mit15 DNA segment, Chr 4, Massachusetts Institute of Technology 15
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D4Mit15 a 329bp 129X1/Sv
f 279bp CD-1
J:42684 Koide T, et al., Mamm Genome. 1998 Jan;9(1):15-9
Endonuclease Gene Allele Fragments Strains
Not Specified D4Mit15 a largest JF1, MSM/Ms
b smaller C57BL/6, DBA/2
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D4Mit15 a 279bp AKR/J, B6.Cg-Lepob/+, C57BL/6J, DBA/2J
b 313bp CAST/EiJ
c 316bp LP/J
d 329bp A/J, BALB/cJ, C3H/HeJ, NOD/MrkTac, NON/ShiLt
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D4Mit15 l smaller LG/J
s larger SM/J
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:42684 Koide T, et al., A new inbred strain JF1 established from Japanese fancy mouse carrying the classic piebald allele [published erratum appears in Mamm Genome 1998 Apr;9(4):344]. Mamm Genome. 1998 Jan;9(1):15-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/31/2026
MGI 6.24
The Jackson Laboratory