D4Mit17 Primer Detail MGI Mouse MGI:700234

D4Mit17 Primer Detail

Name

D4Mit17
Primer 1 Sequence

TGGCCAACCTCTGTGCTTCC
Primer 2 Sequence

ACAGTTGTCCTCTGACATCC
ID

MGI:700234
Product Size

147
Other IDs

D4Mit17 (BROAD)
Note

MIT assay: D1
Additional information: MIT STS Marker Data Files

D4Mit17

DNA segment, Chr 4, Massachusetts Institute of Technology 17

J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D4Mit17	m	150bp	MOLF/EiJ
Not Specified	D4Mit17	s	160bp	129/Sv

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D4Mit17	a	102bp	SPRET/EiJ
	b	133bp	LP/J, NOD/MrkTac, NON/ShiLt
	c	135bp	AKR/J
	d	138bp	DBA/2J
	e	142bp	CAST/EiJ
	f	144bp	A/J, B6.Cg-Lep^ob/+, BALB/cJ, C3H/HeJ, C57BL/6J

J:54496 Rogers MJ, et al., Mamm Genome. 1999 May;10(5):513-9

Gene	Allele	Fragments	Strains
D4Mit17	a	0.15kb	CBA/Ca
	c	0.15kb	CAST/EiJ
	p	0.15kb	STOCK Whrn^wi
	w	0.0kb	STOCK Whrn^wi

J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12

Endonuclease	Gene	Allele	Fragments	Strains
	D4Mit17	l	larger	LG/J
	D4Mit17	s	smaller	SM/J

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D4Mit17	c	148bp	CBA/CaOlaHsd
	D4Mit17	s	137bp	SWR/OlaHsd

J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:54496 Rogers MJ, et al., Genetic mapping of the whirler mutation. Mamm Genome. 1999 May;10(5):513-9

J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 10/07/2025 MGI 6.24