About   Help   FAQ
D4Mit17 Primer Detail
Primers
  • Name
    D4Mit17
  • Primer 1 Sequence
    TGGCCAACCTCTGTGCTTCC
  • Primer 2 Sequence
    ACAGTTGTCCTCTGACATCC
  • ID
    MGI:700234
  • Product Size
    147
  • Other IDs
    D4Mit17 (BROAD)
  • Note
    MIT assay: D1
    Additional information: MIT STS Marker Data Files
Genes
D4Mit17 DNA segment, Chr 4, Massachusetts Institute of Technology 17
Polymorphisms
J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70
Endonuclease Gene Allele Fragments Strains
Not Specified D4Mit17 m 150bp MOLF/EiJ
s 160bp 129/Sv
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D4Mit17 a 102bp SPRET/EiJ
b 133bp LP/J, NOD/MrkTac, NON/ShiLt
c 135bp AKR/J
d 138bp DBA/2J
e 142bp CAST/EiJ
f 144bp A/J, B6.Cg-Lepob/+, BALB/cJ, C3H/HeJ, C57BL/6J
J:54496 Rogers MJ, et al., Mamm Genome. 1999 May;10(5):513-9
Endonuclease Gene Allele Fragments Strains
D4Mit17 a 0.15kb CBA/Ca
c 0.15kb CAST/EiJ
p 0.15kb STOCK Whrnwi
w 0.0kb STOCK Whrnwi
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D4Mit17 l larger LG/J
s smaller SM/J
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D4Mit17 c 148bp CBA/CaOlaHsd
s 137bp SWR/OlaHsd
References
J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:54496 Rogers MJ, et al., Genetic mapping of the whirler mutation. Mamm Genome. 1999 May;10(5):513-9
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory