D1Mit424 Primer Detail MGI Mouse MGI:700225

D1Mit424 Primer Detail

Name

D1Mit424
Primer 1 Sequence

TCTACTCCTGCAGTTTATTAATGGG
Primer 2 Sequence

ATAAAGTGCTACAGGCAATCTGG
ID

MGI:700225
Product Size

125
Other IDs

D1Mit424 (BROAD)
Note

MIT assay: MTH524
Additional information: MIT STS Marker Data Files

D1Mit424

DNA segment, Chr 1, Massachusetts Institute of Technology 424

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D1Mit424	a	113bp	SPRET/EiJ
	b	127bp	AKR/J, B6.Cg-Lep^ob/+, C57BL/6J, NOD/MrkTac
	c	133bp	C3H/HeJ, LP/J, NON/ShiLt
	d	137bp	BALB/cJ
	e	139bp	A/J
	f	141bp	DBA/2J
	g	145bp	CAST/EiJ

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
D1Mit424	a	126 bp	AKR/OlaHsd, C57BL/6JOlaHsd, C57BL/10, SJL/J
	c	136bp	BALB/cJ
	d	140bp	DBA/2J
	h	132bp	129P3/J, C3H/HeJ
	p	144bp	JF1, PWB
	w	138bp	A/JOlaHsd

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 09/30/2025 MGI 6.24