About   Help   FAQ
D1Mit424 Primer Detail
Primers
  • Name
    D1Mit424
  • Primer 1 Sequence
    TCTACTCCTGCAGTTTATTAATGGG
  • Primer 2 Sequence
    ATAAAGTGCTACAGGCAATCTGG
  • ID
    MGI:700225
  • Product Size
    125
  • Other IDs
    D1Mit424 (BROAD)
  • Note
    MIT assay: MTH524
    Additional information: MIT STS Marker Data Files
Genes
D1Mit424 DNA segment, Chr 1, Massachusetts Institute of Technology 424
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D1Mit424 a 113bp SPRET/EiJ
b 127bp AKR/J, B6.Cg-Lepob/+, C57BL/6J, NOD/MrkTac
c 133bp C3H/HeJ, LP/J, NON/ShiLt
d 137bp BALB/cJ
e 139bp A/J
f 141bp DBA/2J
g 145bp CAST/EiJ
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D1Mit424 a 126 bp AKR/OlaHsd, C57BL/6JOlaHsd, C57BL/10, SJL/J
c 136bp BALB/cJ
d 140bp DBA/2J
h 132bp 129P3/J, C3H/HeJ
p 144bp JF1, PWB
w 138bp A/JOlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory