D2Mit9 Primer Detail MGI Mouse MGI:700224

D2Mit9 Primer Detail

Name

D2Mit9
Primer 1 Sequence

GTCTGCACTCTCACCAGCAA
Primer 2 Sequence

CAGCTTGAAATGCCTTTGAG
ID

MGI:700224
Product Size

189
Other IDs

D2Mit9 (BROAD)
Note

MIT assay: M85
Additional information: MIT STS Marker Data Files

D2Mit9

DNA segment, Chr 2, Massachusetts Institute of Technology 9

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D2Mit9	a	174bp	SPRET/EiJ
	b	185bp	NOD/MrkTac, NON/ShiLt
	c	187bp	A/J
	d	190bp	AKR/J, B6.Cg-Lep^ob/+, BALB/cJ, C3H/HeJ, C57BL/6J, LP/J
	e	195bp	CAST/EiJ, DBA/2J

J:66473 Bagella L, et al., J Cell Biochem. 2000 Apr;78(1):170-8

Endonuclease	Gene	Allele	Fragments	Strains
	D2Mit9	a	0.187kb	AEJ/Gn
	D2Mit9	s	0.174kb	M. spretus

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:66473 Bagella L, et al., Genomic organization, promoter analysis, and chromosomal mapping of the mouse gene encoding Cdk9. J Cell Biochem. 2000 Apr;78(1):170-8

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 03/25/2025 MGI 6.24