About   Help   FAQ
D2Mit1 Primer Detail
Primers
  • Name
    D2Mit1
  • Primer 1 Sequence
    CTTTTTCGTATGTGGTGGGG
  • Primer 2 Sequence
    AACATTGGGCCTCTATGCAC
  • ID
    MGI:700216
  • Product Size
    123
  • Other IDs
    D2Mit1 (BROAD)
  • Note
    MIT assay: M128
    Additional information: MIT STS Marker Data Files
Genes
D2Mit1 DNA segment, Chr 2, Massachusetts Institute of Technology 1
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D2Mit1 b larger C57BL/6J
c 120bp C3HeB/FeJLe
f largest FVB/N
J:42684 Koide T, et al., Mamm Genome. 1998 Jan;9(1):15-9
Endonuclease Gene Allele Fragments Strains
Not Specified D2Mit1 a largest JF1
b smaller MSM/Ms
c smallest C57BL/6, DBA/2
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D2Mit1 a 96bp SPRET/EiJ
b 120bp A/J, AKR/J, BALB/cJ, C3H/HeJ, DBA/2J, NOD/MrkTac, NON/ShiLt
c 124bp B6.Cg-Lepob/+, C57BL/6J, LP/J
d 140bp CAST/EiJ
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D2Mit1 l larger LG/J
s smaller SM/J
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D2Mit1 a 124bp C57BL/6W
b 120bp 129/SvW, A.CA/W, AKR/W, BALB/cW, BN/aW, C3H/W, C57BL/10W, CBA/W, DBA/2W
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:42684 Koide T, et al., A new inbred strain JF1 established from Japanese fancy mouse carrying the classic piebald allele [published erratum appears in Mamm Genome 1998 Apr;9(4):344]. Mamm Genome. 1998 Jan;9(1):15-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory