About   Help   FAQ
Cilp1-pA, Cilp1-pB Primer Detail
Primers
  • Name
    Cilp1-pA, Cilp1-pB
  • Primer 1 Sequence
    AGCTGTCGTGAGACTGATGCA
  • Primer 2 Sequence
    AGTGTAAAGGCTGGCAAAACC
  • ID
    MGI:6771376
Genes
Cilp cartilage intermediate layer protein, nucleotide pyrophosphohydrolase
Expression
  • Assay Results
    9
References
J:177564 Bernardo BC, et al., Cartilage Intermediate Layer Protein 2 (CILP-2) Is Expressed in Articular and Meniscal Cartilage and Down-regulated in Experimental Osteoarthritis. J Biol Chem. 2011 Oct 28;286(43):37758-67

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
06/12/2024
MGI 6.13
The Jackson Laboratory