PCR35, PCR29 Primer Detail MGI Mouse MGI:6655

About Help FAQ

PCR35, PCR29 Primer Detail

Name

PCR35, PCR29
Primer 1 Sequence

GTAAGCCTCTTTTTAAAGCTT
Primer 2 Sequence

GACGTTCCTCATCTTCTTCACG
ID

MGI:6655
Region Covered

portion of coding region
Product Size

635bp

Myo6

myosin VI

J:29898 Avraham KB, et al., Nat Genet. 1995 Dec;11(4):369-75

Endonuclease	Gene	Allele	Fragments	Strains
BglI	Myo6	a	not given	C57BL/6J-Myo6^sv
BglI	Myo6	b	not given	C57BL/6J
EcoRI	Myo6	a	not given	C57BL/6J-Myo6^sv
EcoRI	Myo6	b	not given	C57BL/6J
HindIII	Myo6	a	not given	C57BL/6J-Myo6^sv
HindIII	Myo6	b	not given	C57BL/6J
Not Specified	Myo6	a	not given	C57BL/6J-Myo6^sv
Not Specified	Myo6	b	not given	C57BL/6J
PvuII	Myo6	a	not given	C57BL/6J-Myo6^sv
PvuII	Myo6	b	not given	C57BL/6J
SphI	Myo6	a	not given	C57BL/6J-Myo6^sv
SphI	Myo6	b	not given	C57BL/6J

J:29898 Avraham KB, et al., The mouse Snell's waltzer deafness gene encodes an unconventional myosin required for structural integrity of inner ear hair cells. Nat Genet. 1995 Dec;11(4):369-75

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 04/16/2024 MGI 6.23