About   Help   FAQ
PCR35, PCR29 Primer Detail
Primers
  • Name
    PCR35, PCR29
  • Primer 1 Sequence
    GTAAGCCTCTTTTTAAAGCTT
  • Primer 2 Sequence
    GACGTTCCTCATCTTCTTCACG
  • ID
    MGI:6655
  • Region Covered
    portion of coding region
  • Product Size
    635bp
Genes
Myo6 myosin VI
Polymorphisms
J:29898 Avraham KB, et al., Nat Genet. 1995 Dec;11(4):369-75
Endonuclease Gene Allele Fragments Strains
BglI Myo6 a not given C57BL/6J-Myo6sv
b not given C57BL/6J
EcoRI Myo6 a not given C57BL/6J-Myo6sv
b not given C57BL/6J
HindIII Myo6 a not given C57BL/6J-Myo6sv
b not given C57BL/6J
Not Specified Myo6 a not given C57BL/6J-Myo6sv
b not given C57BL/6J
PvuII Myo6 a not given C57BL/6J-Myo6sv
b not given C57BL/6J
SphI Myo6 a not given C57BL/6J-Myo6sv
b not given C57BL/6J
References
J:29898 Avraham KB, et al., The mouse Snell's waltzer deafness gene encodes an unconventional myosin required for structural integrity of inner ear hair cells. Nat Genet. 1995 Dec;11(4):369-75

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/22/2025
MGI 6.24
The Jackson Laboratory