About   Help   FAQ
TJ-2.17 Primer Detail
Primers
  • Name
    TJ-2.17
  • Primer 1 Sequence
    GAGTAGGTTGGAATTTCTCTC
  • Primer 2 Sequence
    ACAAATATACACTACTGGACAA
  • ID
    MGI:665
  • Product Size
    90bp
  • Synonyms
    T35
Genes
D15Nds1 DNA segment, Chr 15, Nuffield Department of Surgery 1
Polymorphisms
J:11484 Cornall RJ, et al., Genomics. 1991 Aug;10(4):874-81
Endonuclease Gene Allele Fragments Strains
D15Nds1 a larger AKR/J
h large B6.PL-Thy1a/SnJ, C57BL/6J, C57BL/10-H2g7
n smallest NOD
o smaller DBA/2J, NON
s largest M. spretus
J:1066 Dietrich W, et al., Genetics. 1992 Jun;131(2):423-47
Endonuclease Gene Allele Fragments Strains
D15Nds1 d 98bp A/J, BALB/cJ, C3H/HeJ, DBA/2J, NON/ShiLt
e 100bp B6.Cg-Lepob/+, C57BL/6J, LP/J
f 146bp CAST/EiJ
h 105bp AKR/J
j 96bp NOD/MrkTac
J:22801 Fiedorek FT Jr, et al., Mamm Genome. 1995 Feb;6(2):123-6
Endonuclease Gene Allele Fragments Strains
D15Nds1 b 96bp C57BLKS/J
z 102bp CZECHII
J:26136 Routman EJ, et al., Mamm Genome. 1995 Jun;6(6):401-4
Endonuclease Gene Allele Fragments Strains
D15Nds1 a largest AKR/J
b smaller C57BL/J
l larger LG/J
s smallest SM/J
References
J:11484 Cornall RJ, et al., The generation of a library of PCR-analyzed microsatellite variants for genetic mapping of the mouse genome. Genomics. 1991 Aug;10(4):874-81
J:1066 Dietrich W, et al., A genetic map of the mouse suitable for typing intraspecific crosses. Genetics. 1992 Jun;131(2):423-47
J:22801 Fiedorek FT Jr, et al., Mapping of the focal adhesion kinase (Fadk) gene to mouse chromosome 15 and human chromosome 8. Mamm Genome. 1995 Feb;6(2):123-6
J:26136 Routman EJ, et al., Polymorphism for PCR-analyzed microsatellites between the inbred mouse strains LG and SM. Mamm Genome. 1995 Jun;6(6):401-4
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory