TJ-2.17 Primer Detail MGI Mouse MGI:665

TJ-2.17 Primer Detail

Name

TJ-2.17
Primer 1 Sequence

GAGTAGGTTGGAATTTCTCTC
Primer 2 Sequence

ACAAATATACACTACTGGACAA
ID

MGI:665
Product Size

90bp
Synonyms

T35

D15Nds1

DNA segment, Chr 15, Nuffield Department of Surgery 1

J:11484 Cornall RJ, et al., Genomics. 1991 Aug;10(4):874-81

Gene	Allele	Fragments	Strains
D15Nds1	a	larger	AKR/J
	h	large	B6.PL-Thy1^a/SnJ, C57BL/6J, C57BL/10-H2^g7
	n	smallest	NOD
	o	smaller	DBA/2J, NON
	s	largest	M. spretus

J:1066 Dietrich W, et al., Genetics. 1992 Jun;131(2):423-47

Gene	Allele	Fragments	Strains
D15Nds1	d	98bp	A/J, BALB/cJ, C3H/HeJ, DBA/2J, NON/ShiLt
	e	100bp	B6.Cg-Lep^ob/+, C57BL/6J, LP/J
	f	146bp	CAST/EiJ
	h	105bp	AKR/J
	j	96bp	NOD/MrkTac

J:22801 Fiedorek FT Jr, et al., Mamm Genome. 1995 Feb;6(2):123-6

Endonuclease	Gene	Allele	Fragments	Strains
	D15Nds1	b	96bp	C57BLKS/J
	D15Nds1	z	102bp	CZECHII

J:26136 Routman EJ, et al., Mamm Genome. 1995 Jun;6(6):401-4

Gene	Allele	Fragments	Strains
D15Nds1	a	largest	AKR/J
	b	smaller	C57BL/J
	l	larger	LG/J
	s	smallest	SM/J

J:11484 Cornall RJ, et al., The generation of a library of PCR-analyzed microsatellite variants for genetic mapping of the mouse genome. Genomics. 1991 Aug;10(4):874-81

J:1066 Dietrich W, et al., A genetic map of the mouse suitable for typing intraspecific crosses. Genetics. 1992 Jun;131(2):423-47

J:22801 Fiedorek FT Jr, et al., Mapping of the focal adhesion kinase (Fadk) gene to mouse chromosome 15 and human chromosome 8. Mamm Genome. 1995 Feb;6(2):123-6

J:26136 Routman EJ, et al., Polymorphism for PCR-analyzed microsatellites between the inbred mouse strains LG and SM. Mamm Genome. 1995 Jun;6(6):401-4

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/30/2025 MGI 6.24