About   Help   FAQ
FK2i, RK2i Primer Detail
Primers
  • Name
    FK2i, RK2i
  • Primer 1 Sequence
    AACTGGGTGTTAGGGAACCA
  • Primer 2 Sequence
    CTTAACTCTCACAAAATCATG
  • ID
    MGI:6639
  • Region Covered
    includes intron 2
Genes
Kras Kirsten rat sarcoma viral oncogene homolog
Polymorphisms
J:29218 Manenti G, et al., Genomics. 1995 Sep 20;29(2):438-44
Endonuclease Gene Allele Fragments Strains
Kras a 0.139kb A/J, M. spretus
b 0.176kb C57BL/6J
FokI Kras a 0.72,0.67kb A/J
b 0.72,0.104kb C57BL/6J
s 0.139kb M. spretus
J:44025 Manenti G, et al., Mamm Genome. 1997;8(11):801-4
Endonuclease Gene Allele Fragments Strains
Not Specified Kras b not given BALB/cJ, SWR/J
c not given C3H/HeJ
References
J:29218 Manenti G, et al., Different susceptibility to lung tumorigenesis in mice with an identical Kras2 intron 2. Genomics. 1995 Sep 20;29(2):438-44
J:44025 Manenti G, et al., Pas1 is a common lung cancer susceptibility locus in three mouse strains. Mamm Genome. 1997;8(11):801-4

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
08/05/2025
MGI 6.24
The Jackson Laboratory