T31 Primer Detail MGI Mouse MGI:662

T31 Primer Detail

Name

T31
Primer 1 Sequence

TGCACACCCACAGCACACATG
Primer 2 Sequence

AAGGTTTAAGAAGGTCAAATCATA
ID

MGI:662
Product Size

140bp
Synonyms

TJ-1.39

D10Nds1

DNA segment, Chr 10, Nuffield Department of Surgery 1

J:11484 Cornall RJ, et al., Genomics. 1991 Aug;10(4):874-81

Gene	Allele	Fragments	Strains
D10Nds1	a	large	AKR/J
	h	smallest	B6.PL-Thy1^a/SnJ, C57BL/6J, C57BL/10-H2^g7, DBA/2J
	n	smaller	NOD
	s	larger	M. spretus

J:1066 Dietrich W, et al., Genetics. 1992 Jun;131(2):423-47

Gene	Allele	Fragments	Strains
D10Nds1	a	152bp	A/J, AKR/J, BALB/cJ, C3H/HeJ, LP/J
	e	130bp	B6.Cg-Lep^ob/+, C57BL/6J, DBA/2J, NON/ShiLt
	f	132bp	CAST/EiJ
	j	145bp	NOD/MrkTac

J:24223 Blackburn CC, et al., Genomics. 1995 Mar 20;26(2):308-17

Gene	Allele	Fragments	Strains
D10Nds1	a	101bp	A.SW-H2^s/Sn, C.NU, CBA.NU, NZC, NZC.NU, NZW.NU
	c	103bp	BALB/cAn, CBA/CaH
	n	109bp	NZW

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D10Nds1	a	142bp	129P2/Ola, 129P3/J, 129T1/Sv-Dnd1^Ter, 129X1/Sv
		b	154bp	129X1/SvJ
		c	142, 148, 154bp	CD-1

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Gene	Allele	Fragments	Strains
D10Nds1	b	smallest	C57BL/6J
	c	148bp	C3HeB/FeJLe
	f	smaller	FVB/N

J:11484 Cornall RJ, et al., The generation of a library of PCR-analyzed microsatellite variants for genetic mapping of the mouse genome. Genomics. 1991 Aug;10(4):874-81

J:1066 Dietrich W, et al., A genetic map of the mouse suitable for typing intraspecific crosses. Genetics. 1992 Jun;131(2):423-47

J:24223 Blackburn CC, et al., A high-resolution map of the chromosomal region surrounding the nude gene. Genomics. 1995 Mar 20;26(2):308-17

J:26136 Routman EJ, et al., Polymorphism for PCR-analyzed microsatellites between the inbred mouse strains LG and SM. Mamm Genome. 1995 Jun;6(6):401-4

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 09/30/2025 MGI 6.24