About   Help   FAQ
T31 Primer Detail
Primers
  • Name
    T31
  • Primer 1 Sequence
    TGCACACCCACAGCACACATG
  • Primer 2 Sequence
    AAGGTTTAAGAAGGTCAAATCATA
  • ID
    MGI:662
  • Product Size
    140bp
  • Synonyms
    TJ-1.39
Genes
D10Nds1 DNA segment, Chr 10, Nuffield Department of Surgery 1
Polymorphisms
J:11484 Cornall RJ, et al., Genomics. 1991 Aug;10(4):874-81
Endonuclease Gene Allele Fragments Strains
D10Nds1 a large AKR/J
h smallest B6.PL-Thy1a/SnJ, C57BL/6J, C57BL/10-H2g7, DBA/2J
n smaller NOD
s larger M. spretus
J:1066 Dietrich W, et al., Genetics. 1992 Jun;131(2):423-47
Endonuclease Gene Allele Fragments Strains
D10Nds1 a 152bp A/J, AKR/J, BALB/cJ, C3H/HeJ, LP/J
e 130bp B6.Cg-Lepob/+, C57BL/6J, DBA/2J, NON/ShiLt
f 132bp CAST/EiJ
j 145bp NOD/MrkTac
J:24223 Blackburn CC, et al., Genomics. 1995 Mar 20;26(2):308-17
Endonuclease Gene Allele Fragments Strains
D10Nds1 a 101bp A.SW-H2s/Sn, C.NU, CBA.NU, NZC, NZC.NU, NZW.NU
c 103bp BALB/cAn, CBA/CaH
n 109bp NZW
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D10Nds1 a 142bp 129P2/Ola, 129P3/J, 129T1/Sv-Dnd1Ter, 129X1/Sv
b 154bp 129X1/SvJ
c 142, 148, 154bp CD-1
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D10Nds1 b smallest C57BL/6J
c 148bp C3HeB/FeJLe
f smaller FVB/N
References
J:11484 Cornall RJ, et al., The generation of a library of PCR-analyzed microsatellite variants for genetic mapping of the mouse genome. Genomics. 1991 Aug;10(4):874-81
J:1066 Dietrich W, et al., A genetic map of the mouse suitable for typing intraspecific crosses. Genetics. 1992 Jun;131(2):423-47
J:24223 Blackburn CC, et al., A high-resolution map of the chromosomal region surrounding the nude gene. Genomics. 1995 Mar 20;26(2):308-17
J:26136 Routman EJ, et al., Polymorphism for PCR-analyzed microsatellites between the inbred mouse strains LG and SM. Mamm Genome. 1995 Jun;6(6):401-4
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory