About   Help   FAQ
TJ-T20 Primer Detail
Primers
  • Name
    TJ-T20
  • Primer 1 Sequence
    GCCTATTTATTTCAAAGATATGAC
  • Primer 2 Sequence
    TGATATCGAGGCATACATGAG
  • ID
    MGI:658
  • Product Size
    115bp
  • Synonyms
    T18
Genes
D15Nds2 DNA segment, Chr 15, Nuffield Department of Surgery 2
Polymorphisms
J:11484 Cornall RJ, et al., Genomics. 1991 Aug;10(4):874-81
Endonuclease Gene Allele Fragments Strains
D15Nds2 d smaller DBA/2J
n largest AKR/J, B6.PL-Thy1a/SnJ, C57BL/6J, C57BL/10-H2g7, NOD, NON
s smallest M. spretus
J:1066 Dietrich W, et al., Genetics. 1992 Jun;131(2):423-47
Endonuclease Gene Allele Fragments Strains
D15Nds2 a 111bp A/J
e 122bp AKR/J, B6.Cg-Lepob/+, C3H/HeJ, C57BL/6J, NOD/MrkTac
f 115bp BALB/cJ, CAST/EiJ, DBA/2J
k 120bp LP/J
J:26136 Routman EJ, et al., Mamm Genome. 1995 Jun;6(6):401-4
Endonuclease Gene Allele Fragments Strains
D15Nds2 a larger AKR/J, C57BL/J
l smallest LG/J
s smaller SM/J
References
J:11484 Cornall RJ, et al., The generation of a library of PCR-analyzed microsatellite variants for genetic mapping of the mouse genome. Genomics. 1991 Aug;10(4):874-81
J:1066 Dietrich W, et al., A genetic map of the mouse suitable for typing intraspecific crosses. Genetics. 1992 Jun;131(2):423-47
J:26136 Routman EJ, et al., Polymorphism for PCR-analyzed microsatellites between the inbred mouse strains LG and SM. Mamm Genome. 1995 Jun;6(6):401-4
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory