TJ-T20 Primer Detail MGI Mouse MGI:658

TJ-T20 Primer Detail

Name

TJ-T20
Primer 1 Sequence

GCCTATTTATTTCAAAGATATGAC
Primer 2 Sequence

TGATATCGAGGCATACATGAG
ID

MGI:658
Product Size

115bp
Synonyms

T18

D15Nds2

DNA segment, Chr 15, Nuffield Department of Surgery 2

J:11484 Cornall RJ, et al., Genomics. 1991 Aug;10(4):874-81

Gene	Allele	Fragments	Strains
D15Nds2	d	smaller	DBA/2J
	n	largest	AKR/J, B6.PL-Thy1^a/SnJ, C57BL/6J, C57BL/10-H2^g7, NOD, NON
	s	smallest	M. spretus

J:1066 Dietrich W, et al., Genetics. 1992 Jun;131(2):423-47

Gene	Allele	Fragments	Strains
D15Nds2	a	111bp	A/J
	e	122bp	AKR/J, B6.Cg-Lep^ob/+, C3H/HeJ, C57BL/6J, NOD/MrkTac
	f	115bp	BALB/cJ, CAST/EiJ, DBA/2J
	k	120bp	LP/J

J:26136 Routman EJ, et al., Mamm Genome. 1995 Jun;6(6):401-4

Gene	Allele	Fragments	Strains
D15Nds2	a	larger	AKR/J, C57BL/J
	l	smallest	LG/J
	s	smaller	SM/J

J:11484 Cornall RJ, et al., The generation of a library of PCR-analyzed microsatellite variants for genetic mapping of the mouse genome. Genomics. 1991 Aug;10(4):874-81

J:1066 Dietrich W, et al., A genetic map of the mouse suitable for typing intraspecific crosses. Genetics. 1992 Jun;131(2):423-47

J:26136 Routman EJ, et al., Polymorphism for PCR-analyzed microsatellites between the inbred mouse strains LG and SM. Mamm Genome. 1995 Jun;6(6):401-4

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 09/30/2025 MGI 6.24