About   Help   FAQ
Hmmr-pA, Hmmr-pB Primer Detail
Primers
  • Name
    Hmmr-pA, Hmmr-pB
  • Primer 1 Sequence
    CCGATCTCAGCTTGTTAAAAGG
  • Primer 2 Sequence
    CCATACTGCTGTTCTGTTCCTG
  • ID
    MGI:6548
  • Region Covered
    intron 13 and a portion of the 3' untranslated region
  • Product Size
    ~1.3kb
Genes
Hmmr hyaluronan mediated motility receptor (RHAMM)
Polymorphisms
J:29693 Spicer AP, et al., Genomics. 1995 Nov 1;30(1):115-7
Notes: The c allele is distinguished from the d allele by the presence of a unique BglII site within the approximately 1.4kb PCR product.
Endonuclease Gene Allele Fragments Strains
Hmmr b 1.4kb C57BL/6J
c not given CASA/RkJ
d not given DF
s 1.2kb M. spretus
References
J:29693 Spicer AP, et al., The human and mouse receptors for hyaluronan-mediated motility, RHAMM, genes (HMMR) map to human chromosome 5q33.2-qter and mouse chromosome 11. Genomics. 1995 Nov 1;30(1):115-7

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory