About   Help   FAQ
Epo-pC, Epo-pD Primer Detail
Primers
  • Name
    Epo-pC, Epo-pD
  • Primer 1 Sequence
    AAAGAATGGAGGTGAGTTGC
  • Primer 2 Sequence
    ACCCACCAACCTCTAAGAAC
  • ID
    MGI:6539
Genes
Epo erythropoietin
Polymorphisms
J:29702 Santos J, et al., Cytogenet Cell Genet. 1995;71(3):223-4
Endonuclease Gene Allele Fragments Strains
Epo b 116bp C57BL/6J, CAST/EiJ, M. m. domesticus, MOLF/EiJ
c 120bp CZECHII, RF/J
s 124bp SPRET/EiJ
J:31797 Santos J, et al., Oncogene. 1996 Feb 1;12(3):669-76
Endonuclease Gene Allele Fragments Strains
Epo b smaller C57BL/6J
r larger RF/J
References
J:29702 Santos J, et al., Eight new polymorphic microsatellites in mouse gene loci. Cytogenet Cell Genet. 1995;71(3):223-4
J:31797 Santos J, et al., Allelic losses on chromosome 4 suggest the existence of a candidate tumor suppressor gene region of about 0.6 cM in gamma-radiation-induced mouse primary thymic lymphomas. Oncogene. 1996 Feb 1;12(3):669-76

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory