About   Help   FAQ
D4Nds16-pA, D4Nds16-pB Primer Detail
Primers
  • Name
    D4Nds16-pA, D4Nds16-pB
  • Primer 1 Sequence
    CTGTAGGCTGCTTTTATCTTTTG
  • Primer 2 Sequence
    TGCCCCTTCAGCACATGCCA
  • ID
    MGI:6524
  • Product Size
    102bp
  • Note
    Primer sequence obtained via Nuffield Department of Surgery website https://www-gene.cimr.cam.ac.uk/todd/public_data/mouse/NDS
  • Synonyms
    223, 223.cloned, 223cloned
Genes
D4Nds16 DNA segment, Chr 4, Nuffield Department of Surgery 16
Polymorphisms
J:459 Hearne CM, et al., Mamm Genome. 1991;1(4):273-82
Notes: Sequences named according to Love et al (1990), Nucl Acids Res 18:4123-4130, and Hearne et al (1991), Mammalian Genome 1:273-282. Some alleles are resolvable on acrylamide, some are resolvable on 4% agarose, other alleles are resolvable by both.
Endonuclease Gene Allele Fragments Strains
D4Smh6b a largest B6.PL-Thy1a, C57BL/10-H2g7
b 2nd largest C57BL/6J
c 3rd largest NOD, NON
d 4th largest AKR/J, DBA/2J
e 5th largest SPR
J:4594 Eicher EM, et al., Mamm Genome. 1993;4(4):226-9
Endonuclease Gene Allele Fragments Strains
D4Smh6b b larger C57BL/6J
s smaller M. spretus
J:15229 Lyon MF, et al., Proc Natl Acad Sci U S A. 1993 Oct 15;90(20):9717-20
Endonuclease Gene Allele Fragments Strains
D4Smh6b c larger C57BL/6J
s smaller M. spretus
J:28719 Lord CJ, et al., Mamm Genome. 1995 Sep;6(9):563-70
Endonuclease Gene Allele Fragments Strains
D4Nds16 b 105bp B6.PL-Thy1a/CyJ
n 108bp NOD/MrkTac
References
J:459 Hearne CM, et al., Additional microsatellite markers for mouse genome mapping. Mamm Genome. 1991;1(4):273-82
J:4594 Eicher EM, et al., Molecular markers that define the distal ends of mouse autosomes 4, 13, and 19 and the sex chromosomes. Mamm Genome. 1993;4(4):226-9
J:15229 Lyon MF, et al., A gene affecting Wallerian nerve degeneration maps distally on mouse chromosome 4. Proc Natl Acad Sci U S A. 1993 Oct 15;90(20):9717-20
J:28719 Lord CJ, et al., Mapping the diabetes polygene Idd3 on mouse chromosome 3 by use of novel congenic strains. Mamm Genome. 1995 Sep;6(9):563-70
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory