D2Ucl29-pA, D2Ucl29-pB Primer Detail MGI Mouse MGI:6459

About Help FAQ

D2Ucl29-pA, D2Ucl29-pB Primer Detail

Name

D2Ucl29-pA, D2Ucl29-pB
Primer 1 Sequence

GACGAGAAGAACCAGATGAT
Primer 2 Sequence

ATGTCAGGCCTCCAGATGAG
ID

MGI:6459
Product Size

214bp

D2Ucl29

DNA segment, Chr 2, University College London 29

J:26240 Malas S, et al., Mouse Genome. 1995;93(2):433-5

Endonuclease	Gene	Allele	Fragments	Strains
	D2Ucl29	b	0.218kb	C57BL/6J
	D2Ucl29	s	0.214kb	M. spretus

J:26240 Malas S, et al., PCR Markers associated with the mouse nicotinic-acetylcholine-receptor-subunit genes alpha-4, alpha-7 and beta-4 on mouse Chromosomes 2, 7, and 9. Mouse Genome. 1995;93(2):433-5

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/28/2024 MGI 6.13