FgfR2IIIa-F, FgfR2IIIb-R Primer Detail MGI Mouse MGI:6402449

About Help FAQ

FgfR2IIIa-F, FgfR2IIIb-R Primer Detail

Name

FgfR2IIIa-F, FgfR2IIIb-R
Primer 1 Sequence

CCCATCCTCCAAGCTGGACTGCCT
Primer 2 Sequence

CTGTTTGGGCAGGACAGTGAGCCA
ID

MGI:6402449
Region Covered

exons 7-8
Synonyms

R2-IIIb primers

Fgfr2

fibroblast growth factor receptor 2

Assay Results

11

J:72517 Hajihosseini MK, et al., A splicing switch and gain-of-function mutation in FgfR2-IIIc hemizygotes causes Apert/Pfeiffer-syndrome-like phenotypes. Proc Natl Acad Sci U S A. 2001 Mar 27;98(7):3855-60

J:144432 Hajihosseini MK, et al., Evidence that Fgf10 contributes to the skeletal and visceral defects of an apert syndrome mouse model. Dev Dyn. 2009 Feb;238(2):376-85

J:150712 Yaguchi Y, et al., Fibroblast growth factor (FGF) gene expression in the developing cerebellum suggests multiple roles for FGF signaling during cerebellar morphogenesis and development. Dev Dyn. 2009 Jun 19;238(8):2058-2072

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/28/2024 MGI 6.13