T62 Primer Detail MGI Mouse MGI:638

T62 Primer Detail

Name

T62
Primer 1 Sequence

CTCCACATGTGTATGTGTATG
Primer 2 Sequence

ATGGAGGCCGAAGAAAGAATC
ID

MGI:638

D7Nds5	DNA segment, Chr 7, Nuffield Department of Surgery 5
Klk1b3	kallikrein 1-related peptidase b3

J:1066 Dietrich W, et al., Genetics. 1992 Jun;131(2):423-47

Gene	Allele	Fragments	Strains
D7Nds5	a	142bp	A/J
	c	143bp	C3H/HeJ, LP/J, NOD/MrkTac, NON/ShiLt
	d	157bp	DBA/2J
	e	145bp	AKR/J, B6.Cg-Lep^ob/+, C57BL/6J
	f	150bp	CAST/EiJ
	g	140bp	BALB/cJ

J:19730 Seldin MF, et al., J Clin Invest. 1994 Jul;94(1):269-76

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D7Nds5	a	114bp	A/J
Not Specified	D7Nds5	b	127bp	C57BL/6J

J:26136 Routman EJ, et al., Mamm Genome. 1995 Jun;6(6):401-4

Gene	Allele	Fragments	Strains
D7Nds5	a	larger	AKR/J, C57BL/J
	l	smaller	LG/J
	s	smallest	SM/J

J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D7Nds5	m	150bp	MOLF/EiJ
Not Specified	D7Nds5	s	165bp	129/Sv

J:1066 Dietrich W, et al., A genetic map of the mouse suitable for typing intraspecific crosses. Genetics. 1992 Jun;131(2):423-47

J:19730 Seldin MF, et al., Glycogen synthase: a putative locus for diet-induced hyperglycemia. J Clin Invest. 1994 Jul;94(1):269-76

J:26136 Routman EJ, et al., Polymorphism for PCR-analyzed microsatellites between the inbred mouse strains LG and SM. Mamm Genome. 1995 Jun;6(6):401-4

J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/07/2024 MGI 6.23