About   Help   FAQ
T62 Primer Detail
Primers
  • Name
    T62
  • Primer 1 Sequence
    CTCCACATGTGTATGTGTATG
  • Primer 2 Sequence
    ATGGAGGCCGAAGAAAGAATC
  • ID
    MGI:638
Genes
D7Nds5 DNA segment, Chr 7, Nuffield Department of Surgery 5
Klk1b3 kallikrein 1-related peptidase b3
Polymorphisms
J:1066 Dietrich W, et al., Genetics. 1992 Jun;131(2):423-47
Endonuclease Gene Allele Fragments Strains
D7Nds5 a 142bp A/J
c 143bp C3H/HeJ, LP/J, NOD/MrkTac, NON/ShiLt
d 157bp DBA/2J
e 145bp AKR/J, B6.Cg-Lepob/+, C57BL/6J
f 150bp CAST/EiJ
g 140bp BALB/cJ
J:19730 Seldin MF, et al., J Clin Invest. 1994 Jul;94(1):269-76
Endonuclease Gene Allele Fragments Strains
Not Specified D7Nds5 a 114bp A/J
b 127bp C57BL/6J
J:26136 Routman EJ, et al., Mamm Genome. 1995 Jun;6(6):401-4
Endonuclease Gene Allele Fragments Strains
D7Nds5 a larger AKR/J, C57BL/J
l smaller LG/J
s smallest SM/J
J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70
Endonuclease Gene Allele Fragments Strains
Not Specified D7Nds5 m 150bp MOLF/EiJ
s 165bp 129/Sv
References
J:1066 Dietrich W, et al., A genetic map of the mouse suitable for typing intraspecific crosses. Genetics. 1992 Jun;131(2):423-47
J:19730 Seldin MF, et al., Glycogen synthase: a putative locus for diet-induced hyperglycemia. J Clin Invest. 1994 Jul;94(1):269-76
J:26136 Routman EJ, et al., Polymorphism for PCR-analyzed microsatellites between the inbred mouse strains LG and SM. Mamm Genome. 1995 Jun;6(6):401-4
J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory