About   Help   FAQ
T63 Primer Detail
Primers
  • Name
    T63
  • Primer 1 Sequence
    GTGACAATACATTCCTGCTGT
  • Primer 2 Sequence
    CTCAGATCTTATCTCTAGCAC
  • ID
    MGI:637
  • Product Size
    ~200bp
Genes
D7Nds4 DNA segment, Chr 7, Nuffield Department of Surgery 4
Fgf3 fibroblast growth factor 3
Polymorphisms
J:1066 Dietrich W, et al., Genetics. 1992 Jun;131(2):423-47
Endonuclease Gene Allele Fragments Strains
D7Nds4 b 166bp AKR/J, BALB/cJ, C57BL/6J, NOD/MrkTac, NON/ShiLt
d 160bp A/J, C3H/HeJ, DBA/2J, LP/J
e 168bp B6.Cg-Lepob/+
f 145bp CAST/EiJ
s 175bp SPRET/EiJ
J:18181 Ord DC, et al., Immunogenetics. 1994;39(5):322-8
Endonuclease Gene Allele Fragments Strains
Fgf3 b not given C57BL/6J
s not given M. spretus
J:26136 Routman EJ, et al., Mamm Genome. 1995 Jun;6(6):401-4
Endonuclease Gene Allele Fragments Strains
D7Nds4 a larger AKR/J, C57BL/J, LG/J
s smaller SM/J
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D7Nds4 a 160bp 129X1/Sv
f 164, 170bp CD-1
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D7Nds4 c 160bp C3HeB/FeJLe
f larger FVB/N
J:42684 Koide T, et al., Mamm Genome. 1998 Jan;9(1):15-9
Endonuclease Gene Allele Fragments Strains
Not Specified D7Nds4 a largest JF1
b smaller MSM/Ms
c smallest C57BL/6, DBA/2
References
J:1066 Dietrich W, et al., A genetic map of the mouse suitable for typing intraspecific crosses. Genetics. 1992 Jun;131(2):423-47
J:18181 Ord DC, et al., CD19 maps to a region of conservation between human chromosome 16 and mouse chromosome 7. Immunogenetics. 1994;39(5):322-8
J:26136 Routman EJ, et al., Polymorphism for PCR-analyzed microsatellites between the inbred mouse strains LG and SM. Mamm Genome. 1995 Jun;6(6):401-4
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:42684 Koide T, et al., A new inbred strain JF1 established from Japanese fancy mouse carrying the classic piebald allele [published erratum appears in Mamm Genome 1998 Apr;9(4):344]. Mamm Genome. 1998 Jan;9(1):15-9
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
08/05/2025
MGI 6.24
The Jackson Laboratory