About   Help   FAQ
T28 Primer Detail
Primers
  • Name
    T28
  • Primer 1 Sequence
    CAGACTTTCATTTCTTTGGATAC
  • Primer 2 Sequence
    ATGCCATCATGTGTTGAAGCA
  • ID
    MGI:636
  • Product Size
    115bp
  • Synonyms
    TJ-2.7
Genes
D7Nds2 DNA segment, Chr 7, Nuffield Department of Surgery 2
Polymorphisms
J:11484 Cornall RJ, et al., Genomics. 1991 Aug;10(4):874-81
Endonuclease Gene Allele Fragments Strains
D7Nds2 d smaller DBA/2J
h largest AKR/J, B6.PL-Thy1a/SnJ, C57BL/6J, C57BL/10-H2g7
n larger NOD, NON
s smallest M. spretus
J:1066 Dietrich W, et al., Genetics. 1992 Jun;131(2):423-47
Endonuclease Gene Allele Fragments Strains
D7Nds2 a 116bp A/J
d 112bp C3H/HeJ, DBA/2J
e 118bp B6.Cg-Lepob/+, C57BL/6J
f 114bp CAST/EiJ, LP/J, NOD/MrkTac, NON/ShiLt
g 119bp AKR/J, BALB/cJ
s 97bp SPRET/EiJ
J:26136 Routman EJ, et al., Mamm Genome. 1995 Jun;6(6):401-4
Endonuclease Gene Allele Fragments Strains
D7Nds2 a larger AKR/J, C57BL/J
l smallest LG/J
s smaller SM/J
J:40661 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):390-3
Endonuclease Gene Allele Fragments Strains
Not Specified D7Nds2 a 108bp 129T1/Sv-Dnd1Ter, 129X1/Sv, C3HeB/FeJ
c 124bp 129P1/ReJ, 129P2/Ola, 129P3/J, 129P4/RrRkJ, 129X1/SvJ
d 112bp C57BL/6J
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D7Nds2 a 108bp 129X1/Sv
b 110, 124bp CD-1
References
J:11484 Cornall RJ, et al., The generation of a library of PCR-analyzed microsatellite variants for genetic mapping of the mouse genome. Genomics. 1991 Aug;10(4):874-81
J:1066 Dietrich W, et al., A genetic map of the mouse suitable for typing intraspecific crosses. Genetics. 1992 Jun;131(2):423-47
J:26136 Routman EJ, et al., Polymorphism for PCR-analyzed microsatellites between the inbred mouse strains LG and SM. Mamm Genome. 1995 Jun;6(6):401-4
J:40661 Threadgill DW, et al., Genealogy of the 129 inbred strains: 129/SvJ is a contaminated inbred strain. Mamm Genome. 1997 Jun;8(6):390-3
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/31/2026
MGI 6.24
The Jackson Laboratory