About   Help   FAQ
Oligonucleotide 947, Oligonucleotide 945 Primer Detail
Primers
  • Name
    Oligonucleotide 947, Oligonucleotide 945
  • Primer 1 Sequence
    CAATTAAAGCTTACTATAAGAAGGATTTTACAA
  • Primer 2 Sequence
    CAAGTTAGATCTAAGCACTAGCTACTCAAACAA
  • ID
    MGI:6305
  • Product Size
    0.21kb
Genes
Hc hemolytic complement
Polymorphisms
J:23983 Wetsel RA, et al., J Biol Chem. 1990 Feb 15;265(5):2435-40
Notes: Genomic DNA from all listed strains was amplified via PCR. Amplified fragments were digested with HindIII and BglII and subcloned into the plasmid pSP72. Inserts were sequenced in both directions to determine if the strain had a 2bp deletion which causedpremature termination of the coding region.
Endonuclease Gene Allele Fragments Strains
Hc n 212bp B10.D2-H2d/nSnJ, BALB/cJ, C57BL/6J, DBA/1J
o 210bp A/HeJ, AKR/J, B10.D2-H2d/oSnJ, DBA/2J, NZB/BlNJ, SWR/J
References
J:23983 Wetsel RA, et al., Deficiency of the murine fifth complement component (C5). A 2-base pair gene deletion in a 5'-exon. J Biol Chem. 1990 Feb 15;265(5):2435-40

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
08/05/2025
MGI 6.24
The Jackson Laboratory