Oligonucleotide 947, Oligonucleotide 945 Primer Detail MGI Mouse MGI:6305

Oligonucleotide 947, Oligonucleotide 945 Primer Detail

Name

Oligonucleotide 947, Oligonucleotide 945
Primer 1 Sequence

CAATTAAAGCTTACTATAAGAAGGATTTTACAA
Primer 2 Sequence

CAAGTTAGATCTAAGCACTAGCTACTCAAACAA
ID

MGI:6305
Product Size

0.21kb

hemolytic complement

J:23983 Wetsel RA, et al., J Biol Chem. 1990 Feb 15;265(5):2435-40

Notes: Genomic DNA from all listed strains was amplified via PCR. Amplified fragments were digested with HindIII and BglII and subcloned into the plasmid pSP72. Inserts were sequenced in both directions to determine if the strain had a 2bp deletion which causedpremature termination of the coding region.

Endonuclease	Gene	Allele	Fragments	Strains
	Hc	n	212bp	B10.D2-H2^d/nSnJ, BALB/cJ, C57BL/6J, DBA/1J
	Hc	o	210bp	A/HeJ, AKR/J, B10.D2-H2^d/oSnJ, DBA/2J, NZB/BlNJ, SWR/J

J:23983 Wetsel RA, et al., Deficiency of the murine fifth complement component (C5). A 2-base pair gene deletion in a 5'-exon. J Biol Chem. 1990 Feb 15;265(5):2435-40

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/14/2024 MGI 6.23