About   Help   FAQ
Igh-C-pA, Igh-C-pB Primer Detail
Primers
  • Name
    Igh-C-pA, Igh-C-pB
  • Primer 1 Sequence
    TAGAGACCATTACACCTAGATTGGAAGACT
  • Primer 2 Sequence
    CTATTCTCTATGTCCCTATTCTGTATTCTG
  • ID
    MGI:63
  • Product Size
    250bp
  • Synonyms
    GA1, GA2
Genes
Igh-C immunoglobulin heavy chain constant region
Polymorphisms
J:10595 Hanzlik AJ, et al., Genomics. 1990 Jul;7(3):389-93
Endonuclease Gene Allele Fragments Strains
Igh-C a not given A/J, DBA/2J
b 240bp BALB/cHuCol-Dnah11iv, C3H/HeJ, C57BL/6J, C57BL/6J-Dnah11iv, PL/J, SJL/J, SWR/J, SWV
c 270bp 129P3/J, AKR/J, BALB/cByJ, C57L/J, C58/J, CAST/EiJ, MEV/1TyJ, NZB/BlNJ
J:3224 de Meeus A, et al., Mamm Genome. 1992;3(11):637-43
Notes: Genomic DNAs from the indicated strains were amplified via PCR, electrophoresed on a 2% low melting/0.5% agarose gel and visualized with ethidium bromide.
Endonuclease Gene Allele Fragments Strains
Igh-C a not given (SI/Col x M. spretus)F1 x SI/Col or SI/Col x M. m. musculus)F1 x SI/Col
m not given MAI
References
J:10595 Hanzlik AJ, et al., The murine situs inversus viscerum (iv) gene responsible for visceral asymmetry is linked tightly to the Igh-C cluster on chromosome 12. Genomics. 1990 Jul;7(3):389-93
J:3224 de Meeus A, et al., A detailed linkage map of subtelomeric murine chromosome 12 region including the situs inversus mutation locus IV. Mamm Genome. 1992;3(11):637-43

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory