119.M22871 Primer Detail MGI Mouse MGI:6234

119.M22871 Primer Detail

Name

119.M22871
Primer 1 Sequence

AGAATCTGACTTACCCATGGT
Primer 2 Sequence

GAGGGAGAAGAATTATGTCTG
ID

MGI:6234
Product Size

143bp
Synonyms

119M22871, M22871

Crp

C-reactive protein, pentraxin-related

J:459 Hearne CM, et al., Mamm Genome. 1991;1(4):273-82

Notes: Sequences named according to Love et al (1990), Nucl Acids Res 18:4123-4130, and Hearne et al (1991), Mammalian Genome 1:273-282. Some alleles are resolvable on acrylamide, some are resolvable on 4% agarose, other alleles are resolvable by both.

Gene	Allele	Fragments	Strains
Crp	a	largest	NOD, NON
	b	2nd largest	DBA/2J, SPR
	c	3rd largest	C57BL/6J, C57BL/10-H2^g7

J:462 Montagutelli X, et al., Mamm Genome. 1991;1(4):255-9

Notes: Sequences named according to Love et al (1990), Nucl Acids Res 18:4123-4130, and Hearne et al (1991), Mammalian Genome 1:273-282.

Gene	Allele	Fragments	Strains
Crp	a	largest	129S2/SvPas, BALB/cPas, C3H/HePas, DDK/Pas, STS/Pas
	b	2nd largest	DBA/2Pas, SEG/Pas, SPE/Pas, SPR/Smh
	c	3rd largest	PWK/Pas
	d	4th largest	C57BL/6Pas

J:1084 Fowlis GA, et al., Mamm Genome. 1992;3(4):192-6

Gene	Allele	Fragments	Strains
Crp	a	largest	AKR/Nimr, BALB/cCrc, C3H/HeCrc, CBA/CaCrc, NOD/Crc
	b	larger	A/JCrc, C58/OlaCrc, NZW/Ola
	c	smaller	B10.D2-H2^d/Nimr, C57L/J

J:20323 Copp AJ, et al., Dev Biol. 1994 Sep;165(1):20-9

Notes: The Lp/+ genotype of strain LPT/Le has both the 95bp and 140bp bands.

Gene	Allele	Fragments	Strains
Crp	a	140bp	A/St, LPT/LeJ
	b	95bp	C57BL/6, LPT/LeJ
	c	150bp	CBA/Ca

J:459 Hearne CM, et al., Additional microsatellite markers for mouse genome mapping. Mamm Genome. 1991;1(4):273-82

J:462 Montagutelli X, et al., PCR-analyzed microsatellites: data concerning laboratory and wild-derived mouse inbred strains. Mamm Genome. 1991;1(4):255-9

J:1084 Fowlis GA, et al., PCR-analyzed microsatellites of the mouse genome--additional polymorphisms among ten inbred mouse strains. Mamm Genome. 1992;3(4):192-6

J:20323 Copp AJ, et al., Developmental basis of severe neural tube defects in the loop-tail (Lp) mutant mouse: use of microsatellite DNA markers to identify embryonic genotype. Dev Biol. 1994 Sep;165(1):20-9

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 09/30/2025 MGI 6.24