88.MUSGNRHGA Primer Detail MGI Mouse MGI:6227

88.MUSGNRHGA Primer Detail

Name

88.MUSGNRHGA
Primer 1 Sequence

ATCAAGTCCCACGAACGTGAT
Primer 2 Sequence

TTTCTCTGGCCTCAAGCAGTA
ID

MGI:6227
Product Size

207bp
Synonyms

88MUSGNRHGA, MUSGNRHGA

Gnrh1

gonadotropin releasing hormone 1

J:459 Hearne CM, et al., Mamm Genome. 1991;1(4):273-82

Notes: Sequences named according to Love et al (1990), Nucl Acids Res 18:4123-4130, and Hearne et al (1991), Mammalian Genome 1:273-282. Some alleles are resolvable on acrylamide, some are resolvable on 4% agarose, other alleles are resolvable by both.

Gene	Allele	Fragments	Strains
Gnrh1	a	largest	B6.PL-Thy1^a, C57BL/6J, C57BL/10-H2^g7
	b	2nd largest	NOD, NON, SPR
	c	3rd largest	AKR/J, DBA/2J

J:462 Montagutelli X, et al., Mamm Genome. 1991;1(4):255-9

Notes: Sequences named according to Love et al (1990), Nucl Acids Res 18:4123-4130, and Hearne et al (1991), Mammalian Genome 1:273-282.

Gene	Allele	Fragments	Strains
Gnrh1	a	largest	SEG/Pas, SPE/Pas
	b	2nd largest	C57BL/6Pas, STS/Pas
	c	3rd largest	DDK/Pas
	d	4th largest	129S2/SvPas, BALB/cPas, C3H/HePas, DBA/2Pas
	e	5th largest	PWK/Pas

J:1084 Fowlis GA, et al., Mamm Genome. 1992;3(4):192-6

Gene	Allele	Fragments	Strains
Gnrh1	a	largest	B10.D2-H2^d/Nimr, C58/OlaCrc, NOD/Crc
	b	larger	A/JCrc, AKR/Nimr, BALB/cCrc, C3H/HeCrc, CBA/CaCrc
	c	smaller	C57L/J, NZW/Ola

J:16291 Metallinos DL, et al., Genetics. 1994 Jan;136(1):217-23

Endonuclease	Gene	Allele	Fragments	Strains
	Gnrh1	c	212bp	CAST/EiJ
	Gnrh1	s	207bp	SSL/Le-Ednrb^s/Ednrb^s-l

J:459 Hearne CM, et al., Additional microsatellite markers for mouse genome mapping. Mamm Genome. 1991;1(4):273-82

J:462 Montagutelli X, et al., PCR-analyzed microsatellites: data concerning laboratory and wild-derived mouse inbred strains. Mamm Genome. 1991;1(4):255-9

J:1084 Fowlis GA, et al., PCR-analyzed microsatellites of the mouse genome--additional polymorphisms among ten inbred mouse strains. Mamm Genome. 1992;3(4):192-6

J:16291 Metallinos DL, et al., Fine structure mapping and deletion analysis of the murine piebald locus. Genetics. 1994 Jan;136(1):217-23

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/14/2024 MGI 6.23