About   Help   FAQ
Dnmt3l-pK, Dnmt3l-pL Primer Detail
Primers
  • Name
    Dnmt3l-pK, Dnmt3l-pL
  • Primer 1 Sequence
    GTGCGGGTACTGAGCCTTTTTAGA
  • Primer 2 Sequence
    CGACATTTGTGACATCTTCCACGTA
  • ID
    MGI:6200899
  • Region Covered
    exon 7-8
  • Synonyms
    3L-5S1, 3L-3A1
Genes
Dnmt3l DNA methyltransferase 3-like
Expression
  • Assay Results
    32
References
J:92186 La Salle S, et al., Windows for sex-specific methylation marked by DNA methyltransferase expression profiles in mouse germ cells. Dev Biol. 2004 Apr 15;268(2):403-15
J:138154 Hu YG, et al., Regulation of DNA methylation activity through Dnmt3L promoter methylation by Dnmt3 enzymes in embryonic development. Hum Mol Genet. 2008 Sep 1;17(17):2654-64
J:194075 Guenatri M, et al., Plasticity in Dnmt3L-dependent and -independent modes of de novo methylation in the developing mouse embryo. Development. 2013 Feb 1;140(3):562-72
J:226694 Matsuzaki H, et al., De novo DNA methylation through the 5'-segment of the H19 ICR maintains its imprint during early embryogenesis. Development. 2015 Nov 15;142(22):3833-44

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory