primer A, primer B Primer Detail MGI Mouse MGI:62

primer A, primer B Primer Detail

Name

primer A, primer B
Primer 1 Sequence

CGACTGTAGAACCTTAGCCTG
Primer 2 Sequence

TGGAGCTGTCCTCCTTGTAG
ID

MGI:62
Region Covered

portion of intron 1

H2-Eb1

histocompatibility 2, class II antigen E beta

J:2976 Padgett KA, et al., J Immunol. 1991 Oct 15;147(8):2764-70

Endonuclease	Gene	Allele	Fragments	Strains
	H2-Eb1	a	0.108kb	B10.A-H2^a, B10.ASR1, B10.ASR11, B10.ASR12, B10.HTT-H2^t3, B10.S-H2^t4/(9R)/J
	H2-Eb1	b	0.112kb	B10.ASR1, B10.ASR7, B10.S-H2^as1/(8R)/J, B10.S-H2^s/J

J:12570 Saha BK, et al., Proc Natl Acad Sci U S A. 1993 Jun 1;90(11):5312-6

Gene	Allele	Fragments	Strains
H2-Eb1	b	66bp	B10.BR-H2^k2 H2-T18^a/SgSnJ, B10.BUA1, B10.BUA19, B10.GAA37, B10.KPA42, B10.KPB128, B10.MOL1, B10.RIII-H2^r/Sn, B10.SM-H2^v, B10.SNA70-H2^w8, B10.W10LT, C57BL/10
	d	98bp	B10.D2-H2^d, B10.MOL1, STU
	f	70bp	B10.DDD, B10.M-H2^f/Sn, B10.S-H2^s/J
	j	58bp	B10.WB-H2^ja/Sn
	p	50.0bp	B10.BAC/K, B10.CHR51, B10.P-H2^p, B10.STC77, C3.W3
	q	74.0bp	B10.Q-H2^q/SgJ, B10.WR7-H2^wr7
	u	106.0bp	B10.NZW, B10.PL-H2^u, FAIYUM-3
	w	93.0bp	B10.LIB55, B10.STA39

J:29073 Ikegami H, et al., J Clin Invest. 1995 Oct;96(4):1936-42

Endonuclease	Gene	Allele	Fragments	Strains
	H2-Eb1	n	93bp	CTS/Shi, NOD/Shi
	H2-Eb1	o	109bp	NON/Shi

J:2976 Padgett KA, et al., Molecular mapping of murine I region recombinants. III. Crossing over at two discrete sites within the beta 1-beta 2 intron of the E beta gene. J Immunol. 1991 Oct 15;147(8):2764-70

J:12570 Saha BK, et al., A highly polymorphic microsatellite in the class II Eb gene allows tracing of major histocompatibility complex evolution in mouse [published erratum appears in Proc Natl Acad Sci U S A 1993 Sep 15;90(18):8757]. Proc Natl Acad Sci U S A. 1993 Jun 1;90(11):5312-6

J:29073 Ikegami H, et al., Identification of a new susceptibility locus for insulin-dependent diabetes mellitus by ancestral haplotype congenic mapping. J Clin Invest. 1995 Oct;96(4):1936-42

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 04/23/2024 MGI 6.23