T23 Primer Detail MGI Mouse MGI:619

T23 Primer Detail

Name

T23
Primer 1 Sequence

GGAATGTCTTATTTAAGTCAG
Primer 2 Sequence

AGTGGAGTAATATTTGAACAA
ID

MGI:619
Product Size

100bp
Synonyms

CA50

D6Nds5

DNA segment, Chr 6, Nuffield Department of Surgery 5

J:11484 Cornall RJ, et al., Genomics. 1991 Aug;10(4):874-81

Gene	Allele	Fragments	Strains
D6Nds5	d	smaller	AKR/J, DBA/2J
	n	larger	B6.PL-Thy1^a/SnJ, C57BL/6J, C57BL/10-H2^g7, NOD
	o	largest	NON
	s	smallest	M. spretus

J:1066 Dietrich W, et al., Genetics. 1992 Jun;131(2):423-47

Gene	Allele	Fragments	Strains
D6Nds5	a	105bp	A/J, BALB/cJ, LP/J, NON/ShiLt
	e	98bp	B6.Cg-Lep^ob/+, C57BL/6J, NOD/MrkTac
	f	108bp	CAST/EiJ
	s	118bp	SPRET/EiJ

J:26136 Routman EJ, et al., Mamm Genome. 1995 Jun;6(6):401-4

Gene	Allele	Fragments	Strains
D6Nds5	b	smaller	C57BL/J
	l	larger	LG/J
	s	smallest	SM/J

J:11484 Cornall RJ, et al., The generation of a library of PCR-analyzed microsatellite variants for genetic mapping of the mouse genome. Genomics. 1991 Aug;10(4):874-81

J:1066 Dietrich W, et al., A genetic map of the mouse suitable for typing intraspecific crosses. Genetics. 1992 Jun;131(2):423-47

J:26136 Routman EJ, et al., Polymorphism for PCR-analyzed microsatellites between the inbred mouse strains LG and SM. Mamm Genome. 1995 Jun;6(6):401-4

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/07/2024 MGI 6.23