About   Help   FAQ
T23 Primer Detail
Primers
  • Name
    T23
  • Primer 1 Sequence
    GGAATGTCTTATTTAAGTCAG
  • Primer 2 Sequence
    AGTGGAGTAATATTTGAACAA
  • ID
    MGI:619
  • Product Size
    100bp
  • Synonyms
    CA50
Genes
D6Nds5 DNA segment, Chr 6, Nuffield Department of Surgery 5
Polymorphisms
J:11484 Cornall RJ, et al., Genomics. 1991 Aug;10(4):874-81
Endonuclease Gene Allele Fragments Strains
D6Nds5 d smaller AKR/J, DBA/2J
n larger B6.PL-Thy1a/SnJ, C57BL/6J, C57BL/10-H2g7, NOD
o largest NON
s smallest M. spretus
J:1066 Dietrich W, et al., Genetics. 1992 Jun;131(2):423-47
Endonuclease Gene Allele Fragments Strains
D6Nds5 a 105bp A/J, BALB/cJ, LP/J, NON/ShiLt
e 98bp B6.Cg-Lepob/+, C57BL/6J, NOD/MrkTac
f 108bp CAST/EiJ
s 118bp SPRET/EiJ
J:26136 Routman EJ, et al., Mamm Genome. 1995 Jun;6(6):401-4
Endonuclease Gene Allele Fragments Strains
D6Nds5 b smaller C57BL/J
l larger LG/J
s smallest SM/J
References
J:11484 Cornall RJ, et al., The generation of a library of PCR-analyzed microsatellite variants for genetic mapping of the mouse genome. Genomics. 1991 Aug;10(4):874-81
J:1066 Dietrich W, et al., A genetic map of the mouse suitable for typing intraspecific crosses. Genetics. 1992 Jun;131(2):423-47
J:26136 Routman EJ, et al., Polymorphism for PCR-analyzed microsatellites between the inbred mouse strains LG and SM. Mamm Genome. 1995 Jun;6(6):401-4
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory