About   Help   FAQ
F3 Primer Detail
Primers
  • Name
    F3
  • Primer 1 Sequence
    CAGCTGAGTCATTAGAGCACTTACC
  • Primer 2 Sequence
    CTCAGACCTACTAGAAGTGCAGAGC
  • ID
    MGI:616
Genes
Cpa1 carboxypeptidase A1, pancreatic
D6Rck1 DNA segment, Chr 6, Rockefeller University 1
Polymorphisms
J:1066 Dietrich W, et al., Genetics. 1992 Jun;131(2):423-47
Endonuclease Gene Allele Fragments Strains
D6Rck1 e 250bp B6.Cg-Lepob/+, DBA/2J
f 230bp CAST/EiJ
s 234bp SPRET/EiJ
J:15209 Chua SC, et al., Mamm Genome. 1993;4(10):555-9
Endonuclease Gene Allele Fragments Strains
Cpa1 b 250.0bp C57BL/6J
c <250.0bp CZECHII
f 250.0bp FVB/NCr
References
J:1066 Dietrich W, et al., A genetic map of the mouse suitable for typing intraspecific crosses. Genetics. 1992 Jun;131(2):423-47
J:15209 Chua SC, et al., The little (lit) mutation cosegregates with the growth hormone releasing factor receptor on mouse chromosome 6. Mamm Genome. 1993;4(10):555-9
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory