About   Help   FAQ
T61 Primer Detail
Primers
  • Name
    T61
  • Primer 1 Sequence
    AGCAGGGCTACACAGAGAAAC
  • Primer 2 Sequence
    ATTCCCATATTTGCATCTCCA
  • ID
    MGI:611
Genes
Afp alpha fetoprotein
D5Nds4 DNA segment, Chr 5, Nuffield Department of Surgery 4
Polymorphisms
J:1066 Dietrich W, et al., Genetics. 1992 Jun;131(2):423-47
Endonuclease Gene Allele Fragments Strains
D5Nds4 d 97bp BALB/cJ, C3H/HeJ, DBA/2J, NOD/MrkTac
e 90bp A/J, AKR/J, B6.Cg-Lepob/+, C57BL/6J
f 85bp CAST/EiJ, LP/J
i 86bp NOD/ShiLt
J:26136 Routman EJ, et al., Mamm Genome. 1995 Jun;6(6):401-4
Endonuclease Gene Allele Fragments Strains
D5Nds4 a smaller AKR/J, C57BL/J
l larger LG/J
s smallest SM/J
References
J:1066 Dietrich W, et al., A genetic map of the mouse suitable for typing intraspecific crosses. Genetics. 1992 Jun;131(2):423-47
J:26136 Routman EJ, et al., Polymorphism for PCR-analyzed microsatellites between the inbred mouse strains LG and SM. Mamm Genome. 1995 Jun;6(6):401-4
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/31/2026
MGI 6.24
The Jackson Laboratory