T26 Primer Detail MGI Mouse MGI:610

T26 Primer Detail

Name

T26
Primer 1 Sequence

TAATCTATTGTTTGTGGAAAG
Primer 2 Sequence

GTATCAGGCAAACTGGACC
ID

MGI:610
Product Size

180bp

D5Nds2

DNA segment, Chr 5, Nuffield Department of Surgery 2

J:1066 Dietrich W, et al., Genetics. 1992 Jun;131(2):423-47

Gene	Allele	Fragments	Strains
D5Nds2	d	178bp	C3H/HeJ, DBA/2J, NON/ShiLt
	e	168bp	A/J, AKR/J, B6.Cg-Lep^ob/+, BALB/cJ, C57BL/6J, LP/J
	f	175bp	CAST/EiJ
	s	122bp	SPRET/EiJ

J:26136 Routman EJ, et al., Mamm Genome. 1995 Jun;6(6):401-4

Endonuclease	Gene	Allele	Fragments	Strains
	D5Nds2	a	smaller	AKR/J, C57BL/J, LG/J
	D5Nds2	s	larger	SM/J

J:1066 Dietrich W, et al., A genetic map of the mouse suitable for typing intraspecific crosses. Genetics. 1992 Jun;131(2):423-47

J:26136 Routman EJ, et al., Polymorphism for PCR-analyzed microsatellites between the inbred mouse strains LG and SM. Mamm Genome. 1995 Jun;6(6):401-4

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 10/07/2025 MGI 6.24