About   Help   FAQ
T29 Primer Detail
Primers
  • Name
    T29
  • Primer 1 Sequence
    TGTAAGCCATTCTAATAGATC
  • Primer 2 Sequence
    GAGGGAATAGAACTGACTGGT
  • ID
    MGI:600
  • Product Size
    90bp
  • Synonyms
    TJ-T26
Genes
D4Nds10 DNA segment, Chr 4, Nuffield Department of Surgery 10
Polymorphisms
J:11484 Cornall RJ, et al., Genomics. 1991 Aug;10(4):874-81
Endonuclease Gene Allele Fragments Strains
D4Nds10 n smaller AKR/J, DBA/2J, M. spretus, NOD
o larger B6.PL-Thy1a/SnJ, C57BL/6J, C57BL/10-H2g7, NON
J:1066 Dietrich W, et al., Genetics. 1992 Jun;131(2):423-47
Endonuclease Gene Allele Fragments Strains
D4Nds10 e 90bp A/J, AKR/J, B6.Cg-Lepob/+, BALB/cJ, C3H/HeJ, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac
f 80bp CAST/EiJ
J:26136 Routman EJ, et al., Mamm Genome. 1995 Jun;6(6):401-4
Endonuclease Gene Allele Fragments Strains
D4Nds10 a smaller AKR/J
b larger C57BL/J
l smallest LG/J, SM/J
J:54496 Rogers MJ, et al., Mamm Genome. 1999 May;10(5):513-9
Endonuclease Gene Allele Fragments Strains
D4Nds10 c 0.085kb CAST/EiJ
w 0.095kb STOCK Whrnwi
References
J:11484 Cornall RJ, et al., The generation of a library of PCR-analyzed microsatellite variants for genetic mapping of the mouse genome. Genomics. 1991 Aug;10(4):874-81
J:1066 Dietrich W, et al., A genetic map of the mouse suitable for typing intraspecific crosses. Genetics. 1992 Jun;131(2):423-47
J:26136 Routman EJ, et al., Polymorphism for PCR-analyzed microsatellites between the inbred mouse strains LG and SM. Mamm Genome. 1995 Jun;6(6):401-4
J:54496 Rogers MJ, et al., Genetic mapping of the whirler mutation. Mamm Genome. 1999 May;10(5):513-9
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory