T29 Primer Detail MGI Mouse MGI:600

T29 Primer Detail

Name

T29
Primer 1 Sequence

TGTAAGCCATTCTAATAGATC
Primer 2 Sequence

GAGGGAATAGAACTGACTGGT
ID

MGI:600
Product Size

90bp
Synonyms

TJ-T26

D4Nds10

DNA segment, Chr 4, Nuffield Department of Surgery 10

J:11484 Cornall RJ, et al., Genomics. 1991 Aug;10(4):874-81

Endonuclease	Gene	Allele	Fragments	Strains
	D4Nds10	n	smaller	AKR/J, DBA/2J, M. spretus, NOD
	D4Nds10	o	larger	B6.PL-Thy1^a/SnJ, C57BL/6J, C57BL/10-H2^g7, NON

J:1066 Dietrich W, et al., Genetics. 1992 Jun;131(2):423-47

Endonuclease	Gene	Allele	Fragments	Strains
	D4Nds10	e	90bp	A/J, AKR/J, B6.Cg-Lep^ob/+, BALB/cJ, C3H/HeJ, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac
	D4Nds10	f	80bp	CAST/EiJ

J:26136 Routman EJ, et al., Mamm Genome. 1995 Jun;6(6):401-4

Gene	Allele	Fragments	Strains
D4Nds10	a	smaller	AKR/J
	b	larger	C57BL/J
	l	smallest	LG/J, SM/J

J:54496 Rogers MJ, et al., Mamm Genome. 1999 May;10(5):513-9

Endonuclease	Gene	Allele	Fragments	Strains
	D4Nds10	c	0.085kb	CAST/EiJ
	D4Nds10	w	0.095kb	STOCK Whrn^wi

J:11484 Cornall RJ, et al., The generation of a library of PCR-analyzed microsatellite variants for genetic mapping of the mouse genome. Genomics. 1991 Aug;10(4):874-81

J:1066 Dietrich W, et al., A genetic map of the mouse suitable for typing intraspecific crosses. Genetics. 1992 Jun;131(2):423-47

J:26136 Routman EJ, et al., Polymorphism for PCR-analyzed microsatellites between the inbred mouse strains LG and SM. Mamm Genome. 1995 Jun;6(6):401-4

J:54496 Rogers MJ, et al., Genetic mapping of the whirler mutation. Mamm Genome. 1999 May;10(5):513-9

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/28/2024 MGI 6.13