T24 Primer Detail MGI Mouse MGI:599

T24 Primer Detail

Name

T24
Primer 1 Sequence

CTTCTGTCTGCTGAGGATACC
Primer 2 Sequence

CCATGATGAGCCAAAATGAAT
ID

MGI:599
Product Size

95bp
Synonyms

CA69

D4Nds2

DNA segment, Chr 4, Nuffield Department of Surgery 2

J:11484 Cornall RJ, et al., Genomics. 1991 Aug;10(4):874-81

Gene	Allele	Fragments	Strains
D4Nds2	h	largest	B6.PL-Thy1^a/SnJ, C57BL/6J, C57BL/10-H2^g7, DBA/2J
	n	larger	AKR/J, NOD
	o	smaller	NON
	s	smallest	M. spretus

J:1066 Dietrich W, et al., Genetics. 1992 Jun;131(2):423-47

Gene	Allele	Fragments	Strains
D4Nds2	a	91bp	A/J
	e	97bp	B6.Cg-Lep^ob/+, BALB/cJ, C3H/HeJ, C57BL/6J, DBA/2J, LP/J
	f	95bp	CAST/EiJ
	h	93bp	AKR/J, NOD/MrkTac
	i	89bp	NON/ShiLt
	s	98bp	SPRET/EiJ

J:20039 Fiedorek FT Jr, et al., Mamm Genome. 1994 Aug;5(8):479-85

Endonuclease	Gene	Allele	Fragments	Strains
	D4Nds2	b	95bp	BKS.D-Dock7^m
	D4Nds2	c	80bp	CZECHII

J:26136 Routman EJ, et al., Mamm Genome. 1995 Jun;6(6):401-4

Gene	Allele	Fragments	Strains
D4Nds2	a	smaller	AKR/J
	b	larger	C57BL/J, SM/J
	l	smallest	LG/J

J:11484 Cornall RJ, et al., The generation of a library of PCR-analyzed microsatellite variants for genetic mapping of the mouse genome. Genomics. 1991 Aug;10(4):874-81

J:1066 Dietrich W, et al., A genetic map of the mouse suitable for typing intraspecific crosses. Genetics. 1992 Jun;131(2):423-47

J:20039 Fiedorek FT Jr, et al., Mapping of PCR-based markers for mouse chromosome 4 on a backcross penetrant for the misty (m) mutation. Mamm Genome. 1994 Aug;5(8):479-85

J:26136 Routman EJ, et al., Polymorphism for PCR-analyzed microsatellites between the inbred mouse strains LG and SM. Mamm Genome. 1995 Jun;6(6):401-4

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 04/23/2024 MGI 6.23