About   Help   FAQ
T24 Primer Detail
Primers
  • Name
    T24
  • Primer 1 Sequence
    CTTCTGTCTGCTGAGGATACC
  • Primer 2 Sequence
    CCATGATGAGCCAAAATGAAT
  • ID
    MGI:599
  • Product Size
    95bp
  • Synonyms
    CA69
Genes
D4Nds2 DNA segment, Chr 4, Nuffield Department of Surgery 2
Polymorphisms
J:11484 Cornall RJ, et al., Genomics. 1991 Aug;10(4):874-81
Endonuclease Gene Allele Fragments Strains
D4Nds2 h largest B6.PL-Thy1a/SnJ, C57BL/6J, C57BL/10-H2g7, DBA/2J
n larger AKR/J, NOD
o smaller NON
s smallest M. spretus
J:1066 Dietrich W, et al., Genetics. 1992 Jun;131(2):423-47
Endonuclease Gene Allele Fragments Strains
D4Nds2 a 91bp A/J
e 97bp B6.Cg-Lepob/+, BALB/cJ, C3H/HeJ, C57BL/6J, DBA/2J, LP/J
f 95bp CAST/EiJ
h 93bp AKR/J, NOD/MrkTac
i 89bp NON/ShiLt
s 98bp SPRET/EiJ
J:20039 Fiedorek FT Jr, et al., Mamm Genome. 1994 Aug;5(8):479-85
Endonuclease Gene Allele Fragments Strains
D4Nds2 b 95bp BKS.D-Dock7m
c 80bp CZECHII
J:26136 Routman EJ, et al., Mamm Genome. 1995 Jun;6(6):401-4
Endonuclease Gene Allele Fragments Strains
D4Nds2 a smaller AKR/J
b larger C57BL/J, SM/J
l smallest LG/J
References
J:11484 Cornall RJ, et al., The generation of a library of PCR-analyzed microsatellite variants for genetic mapping of the mouse genome. Genomics. 1991 Aug;10(4):874-81
J:1066 Dietrich W, et al., A genetic map of the mouse suitable for typing intraspecific crosses. Genetics. 1992 Jun;131(2):423-47
J:20039 Fiedorek FT Jr, et al., Mapping of PCR-based markers for mouse chromosome 4 on a backcross penetrant for the misty (m) mutation. Mamm Genome. 1994 Aug;5(8):479-85
J:26136 Routman EJ, et al., Polymorphism for PCR-analyzed microsatellites between the inbred mouse strains LG and SM. Mamm Genome. 1995 Jun;6(6):401-4
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
10/07/2025
MGI 6.24
The Jackson Laboratory