About   Help   FAQ
F1 Primer Detail
Primers
  • Name
    F1
  • Primer 1 Sequence
    TCAGTATGTACATCCATGCC
  • Primer 2 Sequence
    TAAAAATGATAAGTTGTTTTATGAA
  • ID
    MGI:598
Genes
D4Wsm1 DNA segment, Chr 4, WSM 1
Ifna interferon alpha complex region
Polymorphisms
J:1066 Dietrich W, et al., Genetics. 1992 Jun;131(2):423-47
Endonuclease Gene Allele Fragments Strains
D4Wsm1 e 160bp B6.Cg-Lepob/+
f 185bp CAST/EiJ
J:18898 Rinchik EM, et al., Genetics. 1994 Jul;137(3):845-54
Endonuclease Gene Allele Fragments Strains
Ifna a 160bp 101/Rl
c 150bp C3H/Rl
s 170,165bp M. spretus
J:20039 Fiedorek FT Jr, et al., Mamm Genome. 1994 Aug;5(8):479-85
Endonuclease Gene Allele Fragments Strains
D4Wsm1 b 152bp BKS.D-Dock7m
c 140bp CZECHII
J:31797 Santos J, et al., Oncogene. 1996 Feb 1;12(3):669-76
Endonuclease Gene Allele Fragments Strains
D4Wsm1 b smaller C57BL/6J
r larger RF/J
References
J:1066 Dietrich W, et al., A genetic map of the mouse suitable for typing intraspecific crosses. Genetics. 1992 Jun;131(2):423-47
J:18898 Rinchik EM, et al., Molecular genetics of the brown (b)-locus region of mouse chromosome 4. I. Origin and molecular mapping of radiation- and chemical-induced lethal brown deletions. Genetics. 1994 Jul;137(3):845-54
J:20039 Fiedorek FT Jr, et al., Mapping of PCR-based markers for mouse chromosome 4 on a backcross penetrant for the misty (m) mutation. Mamm Genome. 1994 Aug;5(8):479-85
J:31797 Santos J, et al., Allelic losses on chromosome 4 suggest the existence of a candidate tumor suppressor gene region of about 0.6 cM in gamma-radiation-induced mouse primary thymic lymphomas. Oncogene. 1996 Feb 1;12(3):669-76
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/05/2026
MGI 6.24
The Jackson Laboratory