About   Help   FAQ
p130-pA, p130-pB Primer Detail
Primers
  • Name
    p130-pA, p130-pB
  • Primer 1 Sequence
    GTCATGCCACCTCAAAACCT
  • Primer 2 Sequence
    CGTTGGCAATACTTGGACT
  • ID
    MGI:5907627
Genes
Rbl2 RB transcriptional corepressor like 2
Expression
  • Assay Results
    8
References
J:98713 Spencer C, et al., Distinct patterns of expression of the RB gene family in mouse and human retina. Gene Expr Patterns. 2005 Jun;5(5):687-94

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory