About   Help   FAQ
T21 Primer Detail
Primers
  • Name
    T21
  • Primer 1 Sequence
    ACACATTGGAGATGCACAGCG
  • Primer 2 Sequence
    TCTGCATGCCAGGGTTGTGAT
  • ID
    MGI:588
  • Product Size
    130bp
  • Synonyms
    GT3
Genes
D3Nds2 DNA segment, Chr 3, Nuffield Department of Surgery 2
Polymorphisms
J:11484 Cornall RJ, et al., Genomics. 1991 Aug;10(4):874-81
Endonuclease Gene Allele Fragments Strains
D3Nds2 d smaller DBA/2J
n smallest AKR/J, B6.PL-Thy1a/SnJ, C57BL/6J, C57BL/10-H2g7, NOD, NON
s largest M. spretus
J:1066 Dietrich W, et al., Genetics. 1992 Jun;131(2):423-47
Endonuclease Gene Allele Fragments Strains
D3Nds2 d 122bp DBA/2J
e 115bp A/J, AKR/J, B6.Cg-Lepob/+, BALB/cJ, C3H/HeJ, C57BL/6J, LP/J, NOD/MrkTac, NON/ShiLt
f 147bp CAST/EiJ
s 133bp SPRET/EiJ
J:26136 Routman EJ, et al., Mamm Genome. 1995 Jun;6(6):401-4
Endonuclease Gene Allele Fragments Strains
D3Nds2 a smallest AKR/J, C57BL/J
l largest LG/J
s smaller SM/J
References
J:11484 Cornall RJ, et al., The generation of a library of PCR-analyzed microsatellite variants for genetic mapping of the mouse genome. Genomics. 1991 Aug;10(4):874-81
J:1066 Dietrich W, et al., A genetic map of the mouse suitable for typing intraspecific crosses. Genetics. 1992 Jun;131(2):423-47
J:4074 de Gouyon B, et al., Genetic analysis of diabetes and insulitis in an interspecific cross of the nonobese diabetic mouse with Mus spretus. Proc Natl Acad Sci U S A. 1993 Mar 1;90(5):1877-81
J:26136 Routman EJ, et al., Polymorphism for PCR-analyzed microsatellites between the inbred mouse strains LG and SM. Mamm Genome. 1995 Jun;6(6):401-4
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory