About   Help   FAQ
MHB1666, MHB1667 Primer Detail
Primers
  • Name
    MHB1666, MHB1667
  • Primer 1 Sequence
    TGGCCTGTGGAGTAAGGTCAA
  • Primer 2 Sequence
    GAAGCAGAGGACAAGTTCCCA
  • ID
    MGI:5811102
  • Synonyms
    epsilonY-pF, epsilonY-pR, Hbb-y-pF, Hbb-y-pR
Genes
Hbb-y hemoglobin Y, beta-like embryonic chain
Expression
  • Assay Results
    17
References
J:115753 Yi Z, et al., Sox6 directly silences epsilon globin expression in definitive erythropoiesis. PLoS Genet. 2006 Feb;2(2):e14
J:171578 Chen W, et al., Protein Phosphatase 2A Catalytic Subunit alpha (PP2Acalpha) Maintains Survival of Committed Erythroid Cells in Fetal Liver Erythropoiesis through the STAT5 Pathway. Am J Pathol. 2011 May;178(5):2333-43
J:265272 Ghanem LR, et al., Poly(C)-Binding Protein Pcbp2 Enables Differentiation of Definitive Erythropoiesis by Directing Functional Splicing of the Runx1 Transcript. Mol Cell Biol. 2018 Aug 15;38(16)
J:271614 Gudmundsdottir B, et al., POGZ Is Required for Silencing Mouse Embryonic beta-like Hemoglobin and Human Fetal Hemoglobin Expression. Cell Rep. 2018 Jun 12;23(11):3236-3248
J:340074 Wu J, et al., EHBP1L1, an apicobasal polarity regulator, is critical for nuclear polarization during enucleation of erythroblasts. Blood Adv. 2023 Jul 25;7(14):3382-3394

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory