About   Help   FAQ
Mage-b18-pA, Mage-b18-pB Primer Detail
Primers
  • Name
    Mage-b18-pA, Mage-b18-pB
  • Primer 1 Sequence
    TGAGACAACTTCACAAGTCATTGC
  • Primer 2 Sequence
    TCACGGGCACGGAGTTTG
  • ID
    MGI:5758783
  • Region Covered
    nucleotides 247-442 of GenBank AK046641
Genes
Mageb18 MAGE family member B18
Expression
  • Assay Results
    47
Sequences
AK046641 (GenBank | EMBL | ENA | DDBJ | MGI Sequence Detail)
References
J:230330 Gordeeva O, Expression of the genes of the melanoma antigen (Mage) families in E7.5 mouse embryo. MGI Direct Data Submission. 2016;
J:237181 Gordeeva O, Expression of the genes of the melanoma antigen (Mage) families in placenta. MGI Direct Data Submission. 2016;
J:256265 Gordeeva OF, et al., Expression of Cancer-Testis Antigens of the Mage Family in Mouse Oocytes and Early Embryos. Russ J Dev Biol. 2017;48(4):287-294
J:255000 Gordeeva O, Expression of the genes of the melanoma antigen (Mage) families in brain. MGI Direct Data Submission. 2018;
J:257298 Gordeeva O, Expression of the genes of the melanoma antigen (Mage) families in heart. MGI Direct Data Submission. 2018;
J:257299 Gordeeva O, Expression of the genes of the melanoma antigen (Mage) families in liver. MGI Direct Data Submission. 2018;
J:260954 Gordeeva O, Expression Patterns of Cancer-Testis Antigens of Mage Families in Somatic and Reproductive Organs of Immunocompetent and Immunodeficient Mice. MGI Direct Data Submission. 2018;
J:262143 Gordeeva O, Expression of the genes of the melanoma antigen (Mage) families in male and female gonad. MGI Direct Data Submission. 2018;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory